Informacija

Reikia dviejų deguonies jutiklių E. coli

Reikia dviejų deguonies jutiklių E. coli


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

E. coli turi du deguonies jutiklius: FNR (fumarato-nitrato reduktazė) ir ArcBA (Anoxic Redox Control, dviejų komponentų valdymo sistemos). FNR tiesiogiai jaučia deguonį, o ArcB sąveika su deguonimi yra netiesioginė per chinono telkinį. Iš ten chinonų E. coli, kuri (oksiduotos ir redukuotos visų trijų tipų formos) vaidina, kokiu mastu kuria kryptimi (slopina/aktyvina), yra daug diskutuotina. Norėčiau pamatyti keletą intuityvių argumentų, kodėl ląstelėje net iš principo reikia turėti du deguonies jutiklius?


Neretai ląstelės turi lygiagrečius kelius tam pačiam rezultatui pasiekti. Tai užtikrina patikimą atsaką ir daro sistemą tvirtą. E.coli taip pat turi kitą jutiklį aerotaksiui (Aer ir Tsr baltymai). Žr. mano atsakymą ankstesniame įraše ir susietame dokumente.

Taip pat ieškokite nuoseklių perdavimo tinklo motyvų.


Deguonies ir redokso jutimas naudojant dviejų komponentų sistemas, reguliuojančias elgesio reakcijas: elgesio tyrimai ir struktūriniai oro tyrimai, naudojant in vivo disulfido kryžminį ryšį

Nepaprastai padidėjęs anotuotų aerotaksinių (deguonies ieškančių) ir redokso taksi jutiklių skaičius gali būti siejamas su naujausiais bakterijų genomikos pasiekimais. Tačiau in silico prognozes turėtų paremti elgesio tyrimai ir genetinės analizės, patvirtinančios aerotaksės arba redokso taksi funkciją. Šiame skyriuje pateikiamas procedūrų, kurios buvo labai sėkmingos apibūdinant aerotaksį ir redokso taksi Escherichia coli, rinkinys. Metodai aprašyti pakankamai išsamiai, kad kitų rūšių tyrėjai galėtų pritaikyti procedūras jų naudojimui. Dujų srauto elementas yra naudojamas kiekybiškai įvertinti bakterijų laikiną atsaką į laipsnišką deguonies dalinio slėgio arba redokso potencialo padidėjimą arba sumažėjimą. Bakterijų elgesys erdviniuose gradientuose analizuojamas naudojant optiškai plokščius kapiliarus ir minkštas agaro plokšteles (sukcinato agarą arba triptono agarą). Apibūdiname du būdus, kaip įvertinti pageidaujamą dalinį deguonies slėgį, kuris pritraukia bakterijų rūšis, ši koncentracija yra svarbi norint suprasti mikrobų ekologiją. Molekuliniu lygmeniu aprašome procedūras, naudojamas Aer, aerotaksinio membraninio receptoriaus, struktūrai ir topologijai nustatyti. Cisteino nuskaitymo mutagenezės ir in vivo disulfido kryžminio susiejimo procedūrose naudojamas oksidantas Cu(II)-(1,10-fenantrolinas)(3) ir bifunkciniai su sulfhidrile reaguojantys zondai. Galiausiai aprašome metodus, naudojamus receptorių, tokių kaip Aer, transmembraninių segmentų riboms nustatyti. Tai 5-jodoacetamidofluoresceinas, 4-acetamido-4-disulfonrūgštis, dinatrio druska (AMS) ir metoksipolietilenglikolio maleimidas, 5 kDa molekulinės masės zondas, kuris keičia Aer mobilumą SDS-PAGE.


Fonas

Neinvazinis intracelulinio O aptikimas2 yra ypač svarbus, nes jis yra vienas iš pagrindinių privalomų ir fakultatyvinių aerobinių organizmų metabolitų. Mobilusis O.2 yra svarbus nuo deguonies priklausomos metabolinės veiklos, tokios kaip aerobinis kvėpavimas arba nuo deguonies priklausoma sintezė ir ląstelių komponentų skaidymas, rodiklis [1, 2]. Be to, įvairius biologinius, patologinius ir biotechnologinius procesus kontroliuoja O2 apribojimas, įskaitant bioplėvelės susidarymą ir šeimininko ir patogeno sąveiką [3–7], hipoksijos sukeltus uždegiminius procesus [8], naviko patofiziologiją [9–12], taip pat mikrobų fermentacijos procesus, naudojamus bioremediacijai ir maisto, pašarų bei biokuro gamybai [ 13–16].

Iki šiol skirtingos minimaliai invazinės fluorescencijos ir fosforescencijos pagrindu sukurtos O2- buvo sukurti jautrūs zondai, skirti vaizduoti molekulinį deguonį ląstelėse ir audiniuose. Tarp jų platinos (II)-porfirino dažai plačiai naudojami žinduolių ląstelių hipoksijos sukeltų reakcijų analizei [17–19]. Arba žalias fluorescencinis baltymas (GFP) ir jo variantai gali būti naudojami kaip genetiškai koduoti tarpląsteliniai zondai, kurie yra specifiškai ekspresuojami ir gali būti pasirinktinai nukreipti į apibrėžtas ląsteles ir audinius. Šiame kontekste buvo sukurti mažiausiai du „pasyvūs“ GFP deguonies jutikliai, skirti įvertinti deguonies kiekį ląstelėse. E. coli. Čia GFP buvo naudojamas kaip reporterinis baltymas, išreikštas kontroliuojant deguonį E. coli skatintojai [20, 21]. Be to, buvo taikoma deguoniui jautri GFP sukeltos raudonos fluorescencijos fotoaktyvacija in vivo deguonies vaizdavimas žinduolių ląstelėse ir organuose [22–24].

Pažymėtina, kad molekulinis deguonis šiuo metu negali būti analizuojamas in vivo genetiškai koduotais FRET pagrindu pagamintais biojutikliais, nors šie biojutikliai yra viena iš plačiausiai paplitusių fluorescencinių molekulinių zondų klasių, naudojamų neinvazinei kiekybinei intracelulinių junginių, įskaitant Ca 2+ , Zn 2+ , Cl - , pH, H, analizei.2O2, ATP, maltozė, sacharozė, ribozė ir gliukozė [25–27]. Tačiau, kalbant apie deguonies jutimą, į GFP panašūs baltymai, kurie dažniausiai naudojami kaip FRET biosensorių donorų ir akceptorių domenai, turi didelį trūkumą: jų autokatalizinė chromoforų sintezė griežtai priklauso nuo molekulinio deguonies buvimo [28, 29]. fluorescencinio signalo intensyvumas iš esmės neatspindi susintetinto reporterio baltymo kiekio [30]. Todėl GFP ir jo spalvų variantai negali būti naudojami tik kaip fluorescenciniai biosensoriaus domenai tiksliam O.2 ryžto.

Neseniai sukūrėme naują fluorescencinių baltymų klasę, kurios chromoforas turi flavino mononukleotidą (FMN) [31]. Priešingai nei į GFP panašius FP, šių FMN pagrįstų fluorescencinių baltymų (FbFP) fluorescencijos signalas nepriklauso nuo ląstelių deguonies, todėl FbFP gali būti naudojamas kaip kiekybinis in vivo realaus laiko reporterio baltymas aerobinėmis ir anaerobinėmis sąlygomis [30, 31]. Čia mes pranešame apie pirmojo genetiškai koduoto FRET pagrindu sukurto deguonies biojutiklio, pavadinto FluBO, kurį sudaro deguoniui nejautrus FbFP donoro domenas ir hipoksijai jautrus sustiprinto geltonojo fluorescencinio baltymo (YFP) akceptoriaus domenas, sukūrimą ir pritaikymą. Mes taip pat parodome, kad jo FRET efektyvumas dinamiškai reaguoja į kintantį O2 vertės gyvose bakterijų ląstelėse.


Įvadas

Rhizobia yra alfa-proteobakterijos, kurios dalyvauja simbiozėje su ankštiniais augalais [1]. Bakterijos paverčia inertišką atmosferos N2 į biologiškai prieinamą amoniaką ir tiekia jį savo augalo šeimininkui procese, vadinamame azoto fiksavimu [2,3]. Visą biologinę fiksaciją katalizuoja azoto fermento kompleksas, kuris išsivystė prieš Didįjį deguonies įvykį ir kurio veikimui reikalingos beveik beanoksinės sąlygos [4–6]. Tačiau rizobijos yra privalomi aerobai ir turi kvėpuoti, kad patenkintų didelius azoto fiksavimo energijos poreikius [7, 8]. Šie konkuruojantys reikalavimai sukuria „deguonies paradoksą“ simbiotinėje azoto fiksacijoje [9, 10]. Siekiant įveikti šį paradoksą, išsivystė sudėtingas rizobijų ir jų augalų partnerių bendradarbiavimas (apžvelgta [11, 12]). Ankštiniai augalai priima rizobiją tam skirtuose šaknies mazgeliuose, kurie susidaro ten, kur bakterijos pateko į augalo šaknį, dažniausiai per infekcijos siūlus (apžvelgta [13, 14]). Mazgeliai sukuria beveik anoksinę vidinę aplinką, tinkamą azotinazės veiklai [15–17]. Norėdami sukurti šią aplinką, deguonis (O2) sugauna ir perneša į bakterioidus augalų leghemoglobinai [18–21]. Likusio laisvo O koncentracija2 mazgelių šerdies azoto fiksacijos zonoje yra net 20–50 nM [22,23]. Rhizobia radikaliai keičia gyvenimo būdą po mazgo patekimo, kad išgyventų ir fiksuotų azotą tokiomis sąlygomis (apžvelgta [24, 25]). Neapibrėžtuose mazgeliuose, pvz., gaminamuose Pisum sativum (žirniai), šakniastiebiai iš pradžių gyvena laisvai patekę [26,27]. Tada jie keičia negrįžtamai gyvenimo būdą, kai pereina nuo mazgelio galo prie jo šerdies [28, 29]. Pradedant II zonoje ir įsibėgėjant II-III tarpzonoje, rizobijos galutinai diferencijuojasi į kvaziorganelinius bakterioidus, kurie specializuojasi azoto fiksavimui [30, 31]. III neapibrėžtų mazgelių zonoje yra diferencijuotų bakterioidų, kurie aktyviai fiksuoja azotą [32]. Rizobiniai reguliavimo mechanizmai, jautrūs O2 įtampa yra būtina norint sėkmingai diferencijuotis į bakterioidus ir sukurti produktyvią simbiozę [33–35].

Keli O2 jutikliai išsivystė rizobijoje, iš kurių trys yra plačiai paplitę ir dažnai egzistuoja tame pačiame organizme [11,36]. Pirmasis yra su membrana susietas FixL baltymas, kuris sudaro dviejų komponentų sistemą (TCS) su FixJ imtuvo baltymu (apžvelgta [37, 38]). Mikroerobinėmis sąlygomis FixL fosforilina FixJ, o tai savo ruožtu sukelia pataisytiK transkripcijos faktorius [39–41]. FixK sukelia pasroviui esančių genų ekspresiją, prisijungdamas kaip dimerį prie „anaerobox“ motyvo (TTGAT-N).4-ATCAA) prieš jų promotorius [42,43].

Antrasis dažnas O2 jutiklis yra FixL variantas, vadinamas hibridiniu FixL (hFixL) [44,45]. Tai sudaro alternatyvų TCS su FxkR, veikiančiu kaip imtuvo baltymas. FxkR nėra FixJ homologas, bet panašiai skatina raišką pataisytiK, pririšant prie aukščiau esančio „K-box“ motyvo (GTTACA-N4-GTTACA) [46]. Trečiasis O2 jutiklis yra FnrN transkripcijos faktorius. Kaip ir „FixK“, „FnrN“ suriša anaerobozės motyvą kaip dimeris ir abu yra artimi homologai E. coli anaerobiozės reguliatorius FNR [47–49]. Skirtingai nuo FixK, bet kaip ir FNR, FnrN turi N-galą, kuriame gausu cisteino, todėl baltymas yra tiesioginis O jutiklis.2 [50–53]. Yra žinoma, kad FixL ir hFixL jutikliai suaktyvėja santykinai švelniomis mikroaerobinėmis sąlygomis, įskaitant laisvai gyvenančią rizobiją [54–56]. Tikėtina, kad FnrN bus daug mažiau O2 tolerantiškas. O2 FnrN jautrumas nenustatytas, tačiau E. coli FNR homologas yra aktyvus tik anaerobinėmis sąlygomis [57–59]. Visose iki šiol tirtose simbiotinėse rizobijose naudojamas bent vienas iš šių trijų jutiklių [11]. Įprasta, kad šie jutikliai egzistuoja kartu, ypač viduje Rhizobium leguminosarum biovar viciae VF39, kelios padermės Ensifer meliloti (anksčiau Sinorhizobium meliloti) ir Rhizobium etli CFN42 [44,45,60–62].

Dar labiau pabrėždamas O2 reguliavimas simbiotinėje azoto fiksacijoje, rizobijoje taip pat naudojamas O2 jutimas NifA transkripcijos faktorius, siekiant reguliuoti galutinį jų diferenciaciją į azotą fiksuojančius bakterioidus (apžvalgas žr. [38, 63]). Manoma, kad NifA jautrumas deguoniui atsiranda dėl metalą jungiančio cisteino turinčio motyvo baltymo tarpdomeniniame jungtyje [64–66]. Baltymas turi didelį reguloną, ypač apimantį azotogenazės komponentus, tokius kaip nifH [67–70]. Išraiška nifA paprastai yra automatiškai reguliuojamas rizobijoje, dažnai perskaitant iš prieš tai esančio geno arba operono, kuris yra reguliuojamas NifA, daugeliu atvejų pataisytiABCX [69,71–73]. Rlv3841, a pataisytiABCX operonas randamas tiesiai prieš srovę nifA, siūlantis tokį skaitymo NifA automatinio aktyvinimo mechanizmą. Paprastai nei išraiška nifA taip pat baltymo aktyvumas nėra tiesiogiai reguliuojamas trijų O2 aukščiau aprašyti jutikliai [11]. Viena pastebima išimtis yra E. meliloti, kur nifA yra reguliuojama FixLJ sistemos [74–76]. Nėra įrodymų, kad „FixK“ ar „FnrN“ tiesiogiai reguliuoja nifA išraiška Rlv3841.

Atrodo, kad tarp rizobijų yra spektras, kai kurios rūšys atskiria deguonies jutiklius į atskirus kelius, o kitose rūšyse šie jutikliai iš dalies arba visiškai susiliejo į bendrą hierarchinį kelią [77, 78]. Kai deguonies jutikliai yra atskiruose keliuose, dažnai būna perteklių. Tokiose situacijose vieno deguonies jutiklio praradimas nepanaikina azoto fiksavimo aktyvumo [79,80]. Priešingai, kai jutikliai buvo sujungti į vieną reguliavimo kelią, kai kurie komponentai yra būtini atskirai [11]. Taigi, vieno deguonies jutiklio praradimas gali labai pakenkti azoto fiksacijai, net jei kiti jutikliai lieka.

Į R. leguminosarum bv. VF39, pašalinus FnrN arba hFixL, azoto fiksacija sumažėjo atitinkamai iki 30% arba 50% WT, o tai rodo nehierarchinį, perteklinį išdėstymą [60]. „hFixL-FxkR-FixK“ kelias R. etli CFN42 negalima naudoti kaip dvigubą pataisytiK mutantas neturėjo įtakos azoto fiksacijai, tuo tarpu dvigubas fnrN mutantas sumažino fiksaciją iki 20% WT lygio. Priešingai, R. etli Atrodo, kad CFN42 naudoja sudėtingą hierarchinį kelią, kai keli „FixK“ ir „FnrN“ homologai reguliuoja vienas kito išraišką [61, 62]. Taip pat buvo rasta rūšių, koduojančių tik hFixL arba FnrN homologus. Rhizobium leguminosarum biovar viciae UPM791 yra du FnrN homologai, bet nėra nei FixL, nei hFixL [81]. Nežinoma, ar du FnrN baltymai reaguoja į skirtingą O2 koncentraciją arba veikti nereikalingai. E. meliloti 1021 nėra FnrN homologo, bet gerai ištirta FixLJ sistema ir atrodo, kad turi hFixL ir FxkR homologus [82–84].

Norėdami ištirti ryšį tarp hFixL ir FnrN, ištyrėme modelio organizmą Rhizobium leguminosarum biovar viciae 3841 (Rlv3841), kuriame naudojami abu jutikliai (1 pav.) [85,86]. Rlv3841 turi vieną chromosomą, kurios genų pavadinimai prasideda RL, ir šešias megaplazmides pRL7-12, kurių genų pavadinimai prasideda pvz. pRL9. Pagrindinė simbiotinė plazmidė yra pRL10, tačiau daug simbiotinių genų taip pat randama pRL9, įskaitant fixNOQP ir pataisytiGHIS operonas. Rlv3841 koduoja dvi kopijas hfixL, kurį pavadinome hfixL9 (pRL90020 ant pRL9) ir hfixLc (RL1879 chromosomoje), su 54,9% tapatumu baltymų lygiu. Padermė taip pat turi du homologus (tapatumas 58 %) fxkR, fxkR9 (pRL90026) ir fxkRc (RL1881). Jame yra trys numatomi pataisytiK genai, kuriuos mes nurodėme pataisytiK9a (pRL90019), pataisytiK9b (pRL90025) ir pataisytiKc (RL1880). The pataisytiK9a ir pataisytiK9b sekos turi 53 % aminorūgščių tapatumo, tuo tarpu pataisytiKc turi atitinkamai 38% ir 47% tapatybės su šiais baltymais. Abu pataisytiK9a-hfixL9 ir pataisytiKc-hfixLc atrodo, kad sudaro operonus (1B ir 1D pav.). Rlv3841 turi vieną kopiją fnrN (RL2818), reguliuojamas dviem anaerobox. Panašus dvigubas anaerobox išdėstymas egzistuoja Rlv UPM791, kur FnrN teigiamai ir neigiamai automatiškai reguliuoja savo išraišką [87]. FnrN susiejimas su distaline anaeroboze sukelia fnrN transkripcija ir prisijungimas prie proksimalinės anaerobox jį slopina. Taip pat buvo pranešta apie automatinį FnrN aktyvavimą Rhizobium etli CNPAF512 [88]. FixK reguliavimas fnrN išraiška yra tikėtina, nes ji taip pat jungia anaeroboksus, tačiau tai nebuvo ištirta.

Deguonis rodomas raudonuose deimantuose. Baltymai rodomi kaip ovalai, operatorių vietos – kvadratais, o genai – kaip smailūs stačiakampiai. Transkripcijos pradžios vietos rodomos kaip stačiakampės rodyklės. Eilučių pabaigos nurodo aktyvavimą (rodyklės), slopinimą (bukas galas) ir vertimą (apskritimas). (A) Vienintelis kelias, kurį sudaro du jutikliai, veikia dviem etapais. I stadija prasideda mikroaerobinėmis sąlygomis ir gali veikti už mazgo ribų. Šiame etape hFixL yra aktyvus, bet FnrN ne. hFixL suaktyvina FxkR, kuris prisijungia prie K-box operatorių (oranžiniai K kvadratai), kad sukeltų pataisytiK. FixK prisijungia prie anaerobox operatorių (mėlyni "A" kvadratai), kad sukeltų išraišką, įskaitant prieš srovę fixNOQP (punktyrinė linija) ir fnrN. Kai deguonis bakterijose pasiekia beveik anaerobinį lygį, FnrN tampa aktyvus ir prasideda II stadija. Kaip ir FixK, FnrN suriša anaerodėžus. Jis reguliuojasi automatiškai fnrN tiek teigiamai, tiek neigiamai ir skatina fixNOQP išraiška. (B) Rlv3841 turi kelias kelių deguonies reguliavimo genų kopijas ir daugelis jų yra išsidėstę į grupes. Naudojant megaplazmidę pRL9, pataisytiK9a sudaro operoną su hfixL9, reguliuojama K langeliu. Šis operonas yra greta fixNOQP9, reguliuojama anaerobox. (C) pataisytiK9b ir fxkR9 yra greta, jų tarpgeniniame regione yra anaerobox ir K-box. (D) Rlv3841 chromosoma taip pat turi klasterį, kuriame yra fxkRc, pataisytiKc ir hfixLc. Skirtingai nuo panašių pRL9 grupių, šios grupės tarpgeninėje srityje nėra anaerobox ar K-box operatorių. (E) The fnrN genas nėra klasterio dalis ir yra teigiamai ir neigiamai reguliuojamas distalinės ir proksimalinės anaerobox. Išsamią informaciją apie transkripcijos pradžios vietą, anaerobox ir K-box vietas rasite 1 lentelėje.

Studijoje R. leguminosarum VF39 nustatė, kad mikroaerobinė raiška fnrN taip pat reikalingas RpoN [89]. Ši išvada nebuvo pakartota kitur, o jo reikšmė lieka neaiški. Dirbti R. etli CNPAF512 tai parodė fnrN tame organizme nekontroliuoja RpoN [88]. Rlv3841 koduoja vieną spėjamą rpoN genas (RL0422), bet mes neradome jokių RpoN surišimo vietų prieš Rlv3841 fnrN transkripcijos pradžios vieta. Todėl neatrodo, kad RpoN reikalingas fnrN išraiška Rlv3841.

Lygiagretus hFixL-FxkR-FixK ir FnrN išdėstymas Rlv3841 sukeltų dubliavimą, o nuoseklus išdėstymas sukurtų hierarchiją tarp dviejų reguliatorių. Todėl mūsų tikslas yra suprasti, kaip du jutikliai sąveikauja Rlv3841, ir suteikti informacijos, kodėl jie egzistuoja kartu.


Abstraktus

Mikrobų gedimas ir per maistą plintančios ligos sukelia didelių ekonominių ir produktyvumo nuostolių. Norint pailginti produktų galiojimo laiką, pagerinti kokybę ir mikrobų saugą, sumažinti gedimą ir atliekas, reikia naujų metodų ir antimikrobinio gydymo, taip pat naujų vertinimo metodų. Tradiciniai antimikrobinių medžiagų toksiškumo bandymai užima daug laiko, reikalauja daug darbo, suteikia neapdorotų toksiškumo įvertinimų ir negali analizuoti sudėtingų mėginių, tokių kaip neapdoroti maisto homogenatai. Naudodami pavyzdinį antimikrobinį junginį Lauroyl Arginate Ethyl Ester (LAE), aprašome naują analizės metodiką, pagrįstą optiniu deguonies jutimu ir respirometrija, siekiant ištirti įvairių antimikrobinių procedūrų poveikį grynoms bakterijų kultūroms, mėsos mikrobiotai ir supakuotiems mėsos mėginiams. Matuojant ir analizuojant O laiko profilius2 zondo signalą (fosforescencijos trukmė) inkubuojant bandinius, mes galėjome vizualizuoti toksišką LAE poveikį įvairioms bakterijų rūšims, sukurti laiko ir dozės atsako kreives, apskaičiuoti EC50 ir bandomųjų organizmų generavimo laiką. Naujoji kelių parametrų toksiškumo tyrimo platforma leidžia greitai, automatizuotai ir lygiagrečiai analizuoti kelis mėginius įvairiomis antimikrobinių medžiagų koncentracijomis ir sąlygomis.


E. coli metabolinių jutiklių padermių, turinčių platų jautrumą gliceritui, projektavimas ir inžinerija

Mikrobiniai biojutikliai naudojami išorėje tiekiamų arba viduje gaminamų junginių buvimui nustatyti. Pastarąjį atvejį paprastai riboja poreikis patikrinti didelę fermentų ar kelio variantų biblioteką, kad būtų galima nustatyti tuos, kurie gali efektyviai generuoti norimą junginį. Norėdami išspręsti šį apribojimą, siūlome naudoti metabolinių jutiklių padermes, kurios gali augti tik tuo atveju, jei yra atitinkamas junginys, ir tokiu būdu atranką pakeisti tiesioginiu atranka. Naudojome skaičiavimo platformą, kad sukurtume medžiagų apykaitos jutiklių padermes, turinčias skirtingą priklausomybę nuo konkretaus junginio. Mūsų metodas sistemingai tiria genų ištrynimų derinius ir nustato, kaip kinta junginio augimo poreikis priklausomai nuo terpės sudėties. Šį metodą demonstruojame sukūrę E. coli glicerato jutiklių padermių rinkinį. Kiekvienoje iš šių padermių yra sutrikdytas skirtingas fermentų rinkinys, todėl centrinis metabolizmas efektyviai suskaidomas į kelis segmentus, kurių kiekvienam reikalingas specialus anglies šaltinis. Mes randame beveik tobulą atitikimą tarp numatomos ir eksperimentinės priklausomybės nuo glicerato ir parodome, kad padermės gali būti naudojamos tiksliai nustatyti glicerato koncentraciją dviem dydžiais. Be to, kad parodome galimą metabolinių jutiklių padermių taikymą, mūsų darbas atskleidžia pagrindinius centrinio metabolizmo reiškinius, įskaitant spontanišką centrinių metabolitų skilimą ir medžiagų apykaitos kriauklių svarbą balansuojant mažus metabolinius tinklus.

Raktiniai žodžiai: Auksotrofija Suvaržymais pagrįstas metabolinis modelis Augimo atranka Sintetinė biologija.

Autorių teisės © 2019 Autoriai. Išleido Elsevier Inc. Visos teisės saugomos.


Reaktoriaus inžinerija

13.4.8 Programuotas valdymas

Dėl tam tikro laiko kintančio periodinio ir tiekiamojo fermentavimo pobūdžio pastovios aplinkos arba pastovių metabolinių kintamųjų verčių palaikymas ne visada yra optimali kontrolės strategija. Priklausomai nuo proceso, kintamųjų, tokių kaip pH ir temperatūra, pasikeitimas kritiniu metu gali pagerinti gamybos greitį ir derlių. Keičiant pašarų greitį svarbu fermentuojant kepinių mieles, siekiant sumažinti Crabtree efektą ir maksimaliai padidinti biomasės gamybą. Tiekimo greitis taip pat yra manipuliuojamas E. coli fermentacijos, siekiant sumažinti šalutinių produktų sintezę. Antrinės metabolito fermentacijos metu specifinis augimo greitis turėtų būti didelis kultūros pradžioje, tačiau esant dideliam ląstelių tankiui, norint sulėtinti augimą ir paskatinti produkto susidarymą, reikia skirtingų sąlygų. Panašios strategijos reikalingos norint optimizuoti baltymų sintezę iš rekombinantinių organizmų. Kultūros pradžioje paprastai vengiama rekombinantinio produkto ekspresijos, nes ląstelių augimas yra neigiamai paveiktas, tačiau vėliau serijoje pridedamas induktorius, kuris įjungia baltymų sintezę.

Daugeliui biologinių procesų reikalinga tam tikra pH, temperatūros, ištirpusio deguonies įtempimo, tiekimo greičio ir kitų kintamųjų laiko seka, kad kultūra vystytųsi taip, kad būtų maksimaliai padidintas produktyvumas. Valdymo strategija, kuri gali prisitaikyti prie plataus masto fermentacijos kintamųjų pokyčių užprogramuotas valdymas, taip pat žinomas kaip partijos fermentatoriaus planavimas. Programuoto valdymo atveju valdymo politika susideda iš valdymo funkcijų, kurios turi būti įgyvendinamos įvairiu proceso metu, tvarkaraščio. Šio tipo valdymui reikalingas išsamus proceso reikalavimų supratimas įvairiuose etapuose ir pakankamai išsamus bei tikslus matematinis sistemos modelis.


MEDŽIAGOS IR METODAI

Medžiagos

Mycobacterium tuberculosis H37Rv genominė DNR buvo gauta iš daktaro Jeffery Coxo iš Kalifornijos universiteto San Franciske. Ampicilinas buvo įsigytas iš Fisher Biotech, o chloramfenikolis buvo gautas iš Roche, heminas iš Fluka Biochemica, ditionitas iš JT Baker ir IPTG iš Promega. Lizocimas ir fenilmetilsulfonilfluoridas buvo iš Sigma. Proteazės inhibitoriai (antiskausmas, leupeptinas ir pepstatinas), chloramfenikolis, greito paleidimo didelio tikslumo PGR sistema ir Amplitaq polimerazė buvo gauti iš Roche. 1 kbplus DNR kopėčios buvo nupirktos iš Life technology. Argonas ir CO buvo iš Matheson Tri-Gas.

Simply Blue Safe Stain, In Vision Histag In-Gel Stain, Žiūrėkite Blue Plus 2 baltymų žymeklius, S.O.C. terpė, kartu su gelio aparatu (Novex MiniCell), „NuPage 12% Bis-Tris“ geliai ir „NuPage MOPS SDS“ veikimo buferis buvo įsigyti iš „Invitrogen“. The E. coli XL-10 aukso, BL21DE3 ir XL-1 Blue ląstelės buvo iš Stratagene.

TOPO TA klonavimo rinkinys buvo gautas iš „Invitrogen“, o „QuikChange Mutagenesis“ rinkinys - iš „Stratagene“. DNR gryninimas buvo atliktas naudojant QIAgen rinkinius. Restrikcijos fermentai, T4 DNR ligazė ir šarminė fosfatazė buvo iš New England Biolabs. HisTrap TM HP kolonėlės buvo gautos iš GE Healthcare, o dializės vamzdeliai buvo įsigyti iš Spectrum laboratories, Inc.

pET23a+ plazmidė buvo nupirkta iš Novagen. pTGroE plazmidę maloniai parūpino dr. Shunsuke Ishii iš Molekulinės genetikos laboratorijos, Riken Tsukuba gyvybės mokslų centro, Japonija.

Pradmenys buvo sukurti naudojant GCG programinės įrangos paketo 10.3 versiją, skirtą UNIX iš Viskonsino universiteto. Individualius pradmenis susintetino Invitrogen. Amino rūgščių analizė buvo atlikta Kalifornijos universitete, Davis. DNR mėginiai buvo sekvenuoti Kalifornijos universitete Berklyje.

Viso ilgio „DevS Gene“ klonavimas

DevS genas buvo amplifikuotas iš Mycobacterium tuberculosis H37Rv genominė DNR, naudojant PCR PTC-200 Peltier Thermal Cycler iš MJ Research ir Fast Start High Fidelity PCR sistemą iš Roche. A 10 min. po pradinio denatūravimo 94 ir#x000b0C temperatūroje buvo atlikti 35 ciklai: 94 ir#x000b0C 1 min., 45 ir#x000b0C 1,5 min., 72 ir#x000b0C 3 min. ir 10 min. galutinis pratęsimas 72 ° C temperatūroje. Priekinis pradmuo (GGATAGGGCATATGACAACAGGGGGCCTC) apima an NdeI skilimo vietą, o atvirkštiniame pradmenyje (CCAAACGGGGATCCGAAGAGCTACTGCGACAAC) buvo BamH1 svetainė. Reakcijos mišinyje buvo 4% DMSO. Šioje reakcijoje gautas produktas buvo pakartotinai amplifikuotas tomis pačiomis sąlygomis, kad būtų gautas pakankamas PGR produkto kiekis.

TOPO TA Klonavimas

3 ’ Prie išgryninto PGR produkto, naudojant „Amplitaq“ DNR polimerazę, buvo pridėtos poliadenino perdangos. TOPO TA klonavimo reakcija buvo atlikta 30 minučių kambario temperatūroje pagal gamintojo instrukcijas, naudojant pCR2.1-TOPO vektorių. Plazmidinė DNR buvo išgryninta iš kelių TOP10 ląstelių kolonijų, transformuotų TOPO TA klonavimo reakcijos produktu. DevS geno įterpimas buvo patikrintas naudojant restrikcijos santraukas (arba Ncoaš arba NeI) ir teisinga DevS geno seka buvo patvirtinta DNR sekos nustatymu.

„DevS642“ subklonavimas

Pirmieji 642 bp, koduojantys N-galo GAF domeną, buvo amplifikuoti naudojant tas pačias PGR sąlygas ir šiuos pradmenis: CCGCCGCCATATGCATCATCATCATCATCACGAGAACTTATATTTTCAAGGAATGACAACAGGGGCCTCGTCGAC (priekinis pradmuo su 6-His žyma ir NdeI skilimo vieta) ir CGGACAAGCTTCTATTACGACTGACGCGCCTTAGCCTGCTG (atvirkštinis pradmuo, kuriame yra HindIII vieta). Išgrynintas PGR produktas buvo suardytas Ndeaš ir IndasIII ir liguojama į pET23a+, suskaldytą tais pačiais restrikcijos fermentais, taip pat šarmine fosfataze. XL-10 aukso ultrakompetentingos ląstelės buvo transformuotos ligavimo produktu. Atlikus restrikcijos analizę, plazmidės DNR taip pat buvo pateikta sekai nustatyti, kad būtų patvirtinta teisinga seka.

DevS642 His149 mutagenezė

„Stratagene“ „QuikChange Mutagenesis“ rinkinys buvo naudojamas His149 mutuoti į alaniną pagal gamintojo instrukcijas. Naudoti mutageniniai pradmenys: CGATTGGTTTTCCGCCGTATGCCCCGCCGATGCGTACCTTCCT (priekinis pradmenys) AGGAAGGTACGCATCGGCGGGGCATACGGCGGAAAACCAATCG (atvirkštinis pradmenys). Konstrukcijos buvo pateiktos DNR sekos nustatymui, kad būtų patvirtinta teisinga seka.

DevS642 ir viso ilgio DevS išraiška

BL21gold DE3 ląstelės buvo kartu transformuotos su pET23a + DevS642 ir pT-GroE. Ląstelės buvo auginamos ant LB plokštelių, kuriose buvo ir ampicilino (50 μg/ml), ir chloramfenikolio (34 μg/ml). Po to penkios pradinės kultūros buvo pasėtos po vieną koloniją. Tada penkios kultūros buvo sujungtos ir naudojamos inokuliuoti į kolbas, kuriose yra 1,5 l LB terpės, taip pat antibiotikų ampicilino (100 μg/mL) ir chloramfenikolio (34 μg/ml). Ląstelės buvo auginamos iki optinio tankio OD600 0,8 esant 37 ଌ ir 230 aps./min. Prieš indukciją buvo pridėta Hemin (45 mg/4,5 ml 0,1 N NaOH kiekvienai 1,5 l kultūrai). Baltymų ekspresija buvo sukelta IPTG, kai galutinė koncentracija buvo 1 mM, o kolbos buvo laikomos 18 ± 000 °C temperatūroje 20 valandų. Ląstelės buvo surinktos centrifuguojant 5000 aps./min 25 min. Be to E. coli BL21DE3 buvo išbandytos dar dvi ląstelių linijos: „Rosetta 2“ ir „DH5“ ir#x003b1. DH5α ląstelės neekspresavo norimo baltymo nei tada, kai buvo transformuotos tik DevS642 koduojančia plazmide, nei kai jos buvo kartu transformuotos, kad gautų ir GroEL/ES kompleksą. Rosetta 2 ląstelės taip pat buvo išbandytos, nes keli kodonai mažiau naudojami E. coli buvo identifikuoti geno viduje. Tačiau buvo nustatyta, kad išraiškos lygis nebuvo žymiai padidintas. Viso ilgio DevS buvo klonuotas į pET23a+, naudojant tą pačią strategiją, kaip ir wt DevS642 baltymo atveju. Viso ilgio DevS buvo ekspresuojamas kartu su GroEL / ES kompleksu ir išgrynintas tomis pačiomis sąlygomis.

ApoDevS642 išraiška

Buvo laikomasi tos pačios procedūros, kaip ir su hemo surištu baltymu, išskyrus i) heminą nebuvo pridėta ir ii) buvo imtasi papildomų veiksmų geležies ir kobalto pašalinimui iš auginimo terpės. Buvo naudojama ir pakeista paskelbta procedūra, kad į mineralų mišinį neįtrauktų kobalto druskų (23).

DevS642 mutanto H149A išraiška

Mutantas gali būti išreikštas ir kaip su hemu susijęs baltymas, ir kaip apoproteinas, taikant metodą, naudojamą wt DevS642 atveju. Norint gauti apoproteiną, pakako hemino pridėjimo trūkumo ir nereikėjo jokių tolesnių veiksmų, kad būtų sumažintas užterštumas su hemu susietu rekombinantiniu baltymu. H149A mutanto apoproteinas buvo gautas naudojant LB terpę.

Baltymų valymas

Ląstelės buvo lizuojamos fosfatiniame buferyje, pH 7,6 (50 mM NaH2PO4, 10 % glicerolis, 200 mM NaCl, 1 % Triton X-100, 0,5 mg/mL lizocimas, proteazės inhibitoriai: antiskausmas 1 μg/mL, leupeptinas 1 μM, pepstatinas 1 �,0M SFb c.0,0M). Tada mišinys buvo inkubuojamas purtant 37 ° C temperatūroje 10 minučių. Ląstelių membranos buvo suardytos pakartotiniais 50% ultragarso ciklais, naudojant Branson sonifier 450 iš VWR Scientific, aušinant ant ledo. Netirpi frakcija buvo išskirta centrifuguojant 35 000 aps./min. greičiu 1 valandą 4 °C temperatūroje. Ląstelių lizatas buvo dedamas į 5 ml His gaudyklės kolonėlę 1 ml/min greičiu. Tada kolonėlė plaunama 20 ir 50 mM imidazolu fosfatiniame buferyje (50 mM NaH2PO4, 10 % glicerolio, 500 mM NaCl, 50 ml 2 ml/min greičiu). Rekombinantinis baltymas eliuuojamas 200 mM imidazolu fosfatiniame buferyje (50 ml, 1 ml/min.). Tada mėginys buvo dializuojamas, o frakcijos, kurios nebuvo grynos, buvo pakartotinai išgrynintos His gaudyklėje, kad būtų gautas grynas baltymas. Ši procedūra buvo sėkminga hemo, turinčio wt DevS642 ir H149A, taip pat H149A mutanto apoproteinui. ApoDevS642 izoliacijai buferis buvo pakeistas 20 mM Hepes buferiu (150 mM NaCl pH 8).

Baltymų kiekybinis nustatymas

Baltymų kiekis wt DevS642 buvo nustatytas atliekant aminorūgščių analizę Kalifornijos universitete Deivis. Tirpių baltymų išeiga buvo 16 mg/L kultūros, kai ekspresija buvo koekspresuota su šilumos šoko baltymais GroEL/ES. Tirpių baltymų išeiga, kai jis buvo išreikštas be chaperonų, buvo 2,3 mg/l kultūros.

Wt DevS642 hemo turinio nustatymas

Į baltymų mėginį (80  bcL geležies komplekso) buvo pridėta natrio hidroksido 5 N (5 μL) ir piridino (18 μL). Užregistruotas oksiduotas spektras, o po to pridėta natrio ditionito (keli kristalai), kad būtų gautas sumažintas spektras. Absorbcija ties 539 ir 556 nm buvo naudojama hemo kiekiui nustatyti pagal paskelbtą protokolą (24). Nustatyta, kad hemo kiekis yra 97%.

Wt DevS642 dydžio išskyrimo chromatografija

Rekombinantinio baltymo DevS642 oligomerinė būsena buvo nustatyta naudojant Superdex 75 (FPLC) kolonėlę fosfatinio buferio sistemoje (50 mM fosfato, 200 mM NaCl pH 7,6). Eliuato absorbcija buvo stebima esant dviem bangos ilgiams – 280 ir 406 nm. Tuštumų tūriui nustatyti buvo naudojamas dekstranas (1 mg/ml). Kalibravimo kreivė gauta naudojant šiuos baltymų etalonus: albuminą (MW 66000, 10 mg/mL), alkoholio dehidrogenazę (MW 150000, 5 mg/mL), karboanhidrazę (MW 29000, 3 mg/mL), citochromą c (MW). 12400, 2 mg/ml). DevS642 yra 96% monomerinis (MW 30269, apskaičiuotas pagal gelio filtravimo tyrimą) ir 4% dimerinis (MW 61518).

Wt ApoDevS642 hemino titravimas

500 μL baltymų mėginys (paprastai 5 μM koncentracija Hepes 20 mM, NaCl 150 mM, 10% glicerolio buferis) buvo titruojamas hemino tirpalu. Aliquots of 0.5 μL of a 0.106 mg/mL hemin solution were added and the difference spectrum was recorded 10 min after each addition (the reference cuvette contained buffer and the same amounts of hemin.) To obtain the dissociation constant, 𹒫sorbance 407-350 nm was plotted as a function of hemin concentration and the data points in the titration were fit to the following equation: 𹒫sorbance = Amax/1 + KD/[hemin] (25).

Cyanide and Azide Titrations of Wt DevS642

The concentration of DevS642 was determined based on the intensity of the Soret peak at 407 nm. A 500 μL sample (usual concentration 5 μM) was used in these assays. The initial spectrum of the protein in phosphate buffer (50 mM phosphate and 200 mM sodium chloride) was recorded and then difference spectra were acquired 5 min. after each addition (typically 0.5 μL) of the ligand to both the reference cuvette and the cuvette containing the protein solution. Sodium azide and potassium cyanide were prepared as aqueous solutions in the same buffer. The increase in absorbance at 424 nm (cyanide) or 422 (azide) was plotted as a function of ligand concentration and the data were fit to a rectangular hyperbola (the azide titration) or the quadratic tight binding equation in the case of cyanide (26).

Electronic Absorption and Resonance Raman Spectroscopy

Typical enzyme concentrations used were

100� μM. Biomax-10 ultrafiltration devices (Millipore) were used for buffer exchange and for concentrating the protein. Reduction to the ferrous state was achieved by adding microliter aliquots of 25� mM sodium dithionite solution to an argon-purged sample in the Raman capillary cell and was monitored by UV-visible spectroscopy directly in the capillary using a Cary 50 spectrometer. 12 CO (Airgas) and 13 CO (99% 13 C, ICON Stable Isotopes) adducts were obtained by injecting CO through a septum-sealed capillary containing argon-purged, reduced protein (

20 μL). O2 (Airgas), 18 O2 (99% 18 O, ICON Stable Isotopes), NO (Aldrich), and 15 N 18 O (98% 15 N and 95% 18 O, Aldrich) adducts were generated using the same procedure after excess dithionite was removed from the reduced sample with desalting spin columns (Zebra ™ 0.5 mL, Pierce). These procedures were performed in a glovebox with a controlled atmosphere of less than 1-ppm of O2 (Omni-Lab System, Vacuum Atmospheres Company). RR spectra were obtained using a custom McPherson 2061/207 spectrograph (0.67 m with variable gratings) equipped with a Princeton Instruments liquid N2-cooled CCD detector (LN-1100PB). Kaiser Optical supernotch filters were used to attenuate Raleigh scattering. A Krypton laser (Innova 302, Coherent) and a He/Cd laser (Liconix 4240NB) were used for the 413- and 442-nm excitations, respectively. Spectra were collected in a 90° scattering geometry on samples at room temperature. Frequencies were calibrated relative to indene and CCl4 and are accurate at ଑ cm 𢄡 . CCl4 was also used to check the polarization conditions. The integrity of the RR samples, before and after laser illumination, was confirmed by direct monitoring of their UV-visible spectra in the Raman capillaries.


Išvada

Complications in E. coli-related infection have been mainly attributed to biofilm formation. Biofilm is considerably recalcitrant to antibiotics as compared to its planktonic culture. Escherichia coli biofilm formation is an intricate process which involves a number of steps such as initial adhesion, early development, maturation and dispersion. These steps are governed by a number of genes that serve specific functions in the formation of the biofilm. Type I fimbriae of E. coli plays a crucial role in its attachment to the surface and maturation is further facilitated by autotransporters and EPS. Recent discoveries have also identified stress resistance genes in the biofilm-formation process that help the biofilm to survive in hostile environments. The rpoS gene is majorly responsible for regulating genes and structural proteins involved in the synthesis and degradation of biofilm, under stress conditions.

Escherichia coli biofilm has been found to be resistant to a number of antibiotics, mostly accredited to putative multidrug resistance pump. The development of the extracellular matrix and the observed increased resistance to common antibiotics create a challenge to control the infections caused by E. coli biofilms. Recently there have been advances in exploring and developing new approaches and therapeutic methods to cure E. coli biofilm-related infections.

Molecular and structural understanding of E. coli biofilm has led to the advances in targeting specific agents to curtail infections. Type I pili of E. coli are crucial for the adhesion and initiation of E. coli biofilm formation. The curlicides and pilicides have been designed against curli subunit protein CsgA and type I pili, respectively, and have been shown to inihibit bacterial biofilm. The combination of phages have shown to complement lysis of bacteria through different mechanism of action and yielded promising results. Bacterial biofilm has been notorious in mounting resistance and phytochemicals and AMPs are able to address this issue through their diverse mechanism to target organisms.

One of the major problems faced by these remedial agents is stability and low bioavailability. Natural compound efficacy can be improved by incorporating them in nanoparticles or coating on a particular surface. Silver nanoparticles have shown great promise especially in coating the medical devices and wound dressings and were found to be effective against E. coli biofilm both in vitro ir in vivo mouse model. An antimicrobial nanospray JUC, which was sprayed on a catheter was found to be efficacious in restricting E. coli biofilm formation. These new methods hold a great promise but the issues concerning in vivo efficacy, toxicity and large-scale production need to be addressed before these potential therapeuticals can reach the clinical stage.


Padėkos

We acknowledge funding by the Bundesministerium für Wirtschaft und Technologie within the framework of Zentrales Innovationsprogramm Mittelstand (ZIM). We also wish to thank Steffen Wagner and Stefan Ortleb for excellent technical assistance.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

Fig. S1 The influence of PFD immersion on the photosynthetic output of a sycamore leaf.

Fig. S2 The effect of the photosynthesis inhibitor DCMU on light-dependent oxygen production in the sycamore leaf.

Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.