Informacija

Ar yra in vivo amiloido beta toksiškumo įrodymų?

Ar yra in vivo amiloido beta toksiškumo įrodymų?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Manoma, kad amiloidas beta yra toksiškas, tačiau, remiantis trumpa paieška, tai pagrįsta (1) in vitro (2) kai kurių toksiškumo rodiklių matavimais (pvz., itin jautrus Ca2+ patekimo į lipidų pūsleles, kurias sukelia baltymų agregatai, nurodytos Vikipedijoje, matavimas). .

Mano įspūdis, kad mes neturime jokių aukštos kokybės įrodymų, kad amiloidas beta yra toksiškas in vivo ir kad yra reikšmingų netiesioginių įrodymų, kad jis nėra toksiškas (nuorodos žemiau). Ar tai teisinga?

  1. "30% pagyvenusių žmonių turi #Alzheimers patologiją (apnašas ir (arba) susivėlimus), bet neturi ligos"
  2. Yra pagyvenusi moteris, turinti daug amiloidinių plokštelių, bet neturinti Alzheimerio ligos simptomų
  3. Pasak Dereko Lowe'o, „visi tie amiloido antikūnų tyrimai baigėsi skaudžiais ir brangiais nesėkmėmis“.

Iš greitos paieškos atrodo, kad yra daug svarių įrodymų in vivo toksinis poveikis. Pora popierių čia ir čia.


Sisteminė amiloido β patogeniškumą lemiančių veiksnių in vivo analizė

Filialai Chemijos katedra, Kembridžo universitetas, Kembridžas, Jungtinė Karalystė , Biochemijos katedra, Kembridžo universitetas, Kembridžas, Jungtinė Karalystė, Genetikos katedra, Kembridžo universitetas, Kembridžas, Jungtinė Karalystė

Affiliation Dipartimento di Scienze Biochimiche, Università degli Studi di Firenze, Firenze, Italija

Kembridžo universiteto Chemijos katedra, Kembridžas, Jungtinė Karalystė

Filialai Medicinos skyrius, Kembridžo universitetas, Kembridžas, Jungtinė Karalystė, Kembridžo medicinos tyrimų institutas, Kembridžas, Jungtinė Karalystė

Chemijos katedra, Kembridžo universitetas, Kembridžas, Jungtinė Karalystė

* Kam turėtų būti adresuota korespondencija. El. paštas: [email protected]

Filialai Kembridžo universiteto Genetikos katedra, Kembridžas, Jungtinė Karalystė, Kembridžo universiteto Medicinos katedra, Kembridžas, Jungtinė Karalystė


Įvadas

Alzheimerio ligai būdingas senatvinių plokštelių, daugiausia sudarytų iš β-amiloido peptido (Aβ), nusėdimas smegenyse. Amiloido kaskados hipotezė teigia, kad sergant Alzheimerio liga Aβ kaupimasis smegenyse galiausiai lemia tau metabolizmo pokyčius, dėl kurių tau nusėda neurofibriliniuose raizginiuose (NFT), kurie yra tikėtina proksimalinė neuronų praradimo priežastis. liga [25]. Nors vis dar kyla didelių ginčų dėl to, ar amiloido kaskados hipotezė paaiškina Alzheimerio patologiją [28, 39, 72], yra daug įrodymų (in vitro ir in vivo), kad neuronų poveikis Aβ gali sukelti tau hiperfosforilinimą, galimą veiksnį. tau nusėdimo [23, 51, 87]. Buvo nustatytos kelios tau kinazės (apžvelgtos [57]), taip pat būdai, kuriais šios kinazės gali būti suaktyvintos, kad padidėtų tau fosforilinimas [15, 55, 89]. CDK5 ir GSK3β pasirodė kaip stiprūs kandidatai į ligai svarbias tau kinazes [27, 50], ir abiejų šių kinazių aktyvacija gali įvykti po kalpaino aktyvacijos. Kalpainai yra nuo kalcio priklausomos proteazės, kurios gali skaidyti P35, kad susidarytų P25, stiprus CDK5 aktyvatorius [81], arba tiesiogiai sutrumpinti GSK3β, sukeldamos jo aktyvavimą [34]. Daugelis tyrimų taip pat parodė, kad neuronų poveikis Aβ gali sukelti kalcio antplūdį [30, 77, 78], todėl egzistuoja gerai palaikomas molekulinis mechanizmas, paaiškinantis, kaip Aβ poveikis gali sukelti tau hiperfosforilinimą. Mažiau aiškus yra Aβ sukelto tau fosforilinimo biologinis pagrindas. Ar tai yra pasirinkta Aβ funkcija, netiesioginė išsivysčiusios Aβ sąveikos su ląstelėmis pasekmė, ar iš esmės atsitiktinė sąveika su galimai žalingais rezultatais?

Spręsti „kodėl“ Aβ sukelia tau fosforilinimą apsunkina netikrumas, kokia pasirinkta Aβ peptido funkcija, jei tokia yra. Panašiai neišspręsta, kaip tarpląstelinis Aβ sukelia kalcio padidėjimą ląstelėse. Aβ toksiškumas daugelyje modelių gali būti susilpnintas blokuojant NMDA tipo glutamato receptorius [5, 11, 24], o tai rodo, kad šis kalcio kanalas gali būti atsakingas už nuo Aβ priklausomą kalcio antplūdį. Panašiai teigiama, kad priono baltymas yra Aβ oligomerų [7, 44, 74] ir vidutinio nuo Aβ priklausomo kalcio antplūdžio receptorius [67]. Kiti tyrimai parodė, kad AMPA glutamato receptoriai [2, 73, 88] arba L tipo įtampos valdomi kalcio kanalai [4] padidina citoplazmos kalcio kiekį, atsirandantį dėl Aβ poveikio. Nors keli kalcio kanalai gali būti susiję su Aβ priklausomu kalcio antplūdžiu, kiti tyrimai rodo, kad Aβ oligomerai gali veikti nepriklausomai nuo endogeninių kalcio kanalų, tiesiogiai sudarydami kalciui pralaidžias poras. Jau seniai žinoma, kad sintetinis Aβ gali sudaryti jonams pralaidžius kanalus sintetinėse membranose [6], o tai dažnai kartojama [29, 41, 71]. Nors į žiedą panašios Aβ oligomerų struktūros buvo vizualizuotos atominės jėgos mikroskopu sintetinėse membranose [46], Aβ membranos poros patologiškai svarbiose ląstelėse nebuvo tiesiogiai vizualizuotos ar ištirtos.

Vienas iš būdų, kaip nustatyti, ar Aβ poros yra svarbios Aβ neurotoksiškumui, yra nustatyti Aβ sekos pakaitalus, kurie blokuoja porų susidarymą sintetinėse membranose, ir tada nustatyti, ar šie pakeitimai keičia Aβ toksiškumą. Kim ir kt. [41] pastebėjo sekos motyvą (Gly-XXX-Gly-XXX-Gly), esantį tiek Aβ C gale, tiek bakterijų kanalų baltymų transmembraniniuose domenuose, ir jie pasiūlė, kad šis motyvas („glicino užtrauktukas“) galėtų palengvinti. α-spiralinė sąveika, skatinanti Aβ oligomerų surinkimą membranose ir vėlesnį porų susidarymą. Šie tyrėjai įrodė, kad leucino pakaitalai šiose glicino liekanose (ypač Gly 37 Leu) neleido sintetiniams Aβ 1–42 susidaryti jonų kanalams sintetinėse membranose ir taip pat žymiai sumažino Aβ toksiškumą Neuro 2A ląstelėse. Fonte ir kt. [20] išplėtė šiuos rezultatus ir parodė, kad Gly 37 Leu pakaitalas sumažino Aβ toksiškumą in vivo transgeniniame kūne. C. elegans modelis, kuris išreiškia žmogaus Aβ ir neleido sintetiniams Aβ oligomerams sukelti tau hiperfosforilinimo hipokampo neuronuose. Peters ir kt. [68] vėliau parodė, kad pentapeptidas, gautas iš glicino užtrauktuko sekos (GLMVG), slopina Aβ sinaptotoksiškumą. Šie stebėjimai atitinka porų susidarymą, pagrindžiantį Aβ neurotoksiškumą, tačiau jie tiesiogiai neparodo porų susidarymo ir negali atmesti kitų interpretacijų, pavyzdžiui, galimybės, kad glicino užtrauktuko pakaitalai trukdo sąveikai su specifiniais ląstelės paviršiaus receptoriais.

Alternatyvus būdas daryti išvadą apie Aβ porų susidarymą yra ieškoti jo gebėjimo sukelti žinomą biologinį atsaką į egzogeniškai sukeltas poras, o ne bandyti atvaizduoti pačias poras. Andrewsas ir kolegos apibrėžė membranos atstatymo būdą, kuris atsiranda reaguojant į streptolizino O (SLO), gerai apibūdinto bakterijų poras formuojančio toksino, poveikį [32]. Kaip parodyta 1 pav., šis kelių etapų atkūrimo kelias apima: 1) kalcio patekimą per SLO poras, 2) vietinių lizosomų susiliejimą su plazmos membrana, išlaisvindamas lizosomų turinį, 3) šalia esančių sfingolipidų skilimą išoriniame lapelyje. plazmos membraną lizosomų kilmės rūgštine sfingomielinaze, taip sukeldama lokalizuotą membranos kreivumą į vidų, ir 4) porų turinčios plazmos membranos pašalinimą endocitozės būdu. Nors skirtingų klasių poras formuojantiems toksinams naudojami skirtingi membranos atstatymo mechanizmai [19], jei Aβ sukeltas kalcio antplūdis atsiranda dėl SLO analogiškos poros, galima daryti tris tvirtas prognozes: 1) Aβ poveikis sukels nuo sfingomielinazės priklausomą poveikį. endocitozė, 2) netoksiški Aβ variantai (pvz., Aβ42 Gly 37 Leu) nesugebės sukelti membranos atstatymo, nes jie negali tinkamai oligomerizuotis, kad susidarytų membranos poros, ir 3) poras formuojančių toksinų poveikis imituos Aβ oligomerų poveikį, ypač tau hiperfosforilinimą. Čia mes išbandome šias prognozes naudodami romaną C. elegans žiurkių hipokampo neuronų modelis ir pirminės kultūros.

Membranos remonto modelis. Šis modelis pagrįstas plazminės membranos (PM) porų, susidarančių žinduolių ląstelėse, veikiant bakterijų poras formuojančiam toksinui SLO, atstatymo mechanizmu [32]. ASM yra rūgštinė spingomielinazė, saugoma lizosomose, kurios susilieja su PM, reaguodamos į Ca2+ antplūdį per SLO sukurtas poras (1 veiksmas), tokiu būdu išlaisvindama ASM ląstelės paviršiuje (2 veiksmas). Vietinis ASM išsiskyrimas atskiria sfingomielinazės fosforilo galvučių grupę, esančią netoli porų, kad toje srityje susidarytų keramidas (3 veiksmas). Dėl to PM aplink poras išlinksta į vidų ir endocituojasi taip, kad poros pašalinamos iš PM (4 veiksmas)

Transgeninis C. elegans buvo sukurtos padermės, ekspresuojančios žmogaus Aβ42 [16, 17, 18, 47, 82], ir šios padermės turi įvairių fenotipų, priklausomai nuo to, kur transgenas yra išreikštas. Šių modelių painiava yra ta, kad aptinkamas Aβ yra tarpląstelinis, kai jis tiriamas imunohistochemijos metodu, todėl išorinio Aβ toksiškumo (ty tarpląstelinio Aβ, veikiančio kaimynines ląsteles) laipsnis yra neaiškus. Norėdami apeiti šį apribojimą, sukūrėme „šėrimo“ modelį, kuriame C. elegans yra maitinamas E. coli sukurtas išskirti žmogaus Aβ, o šio egzogeninio peptido poveikis ląstelėms yra tiriamas žarnyno ląstelėse. Vienas iš šio modelio priežasčių yra tas, kad C. elegans žarnynas neekspresuoja kandidatų Aβ receptorių (pvz., priono baltymo, NMDA glutamato receptorių, α7nAChR ir kt.), todėl bet koks fiziologinis atsakas į Aβ greičiausiai nebus sukeltas receptorių. Skaidrumas C. elegans ir atitinkamų transgeninių reporterių padermių buvimas leidžia stebėti Aβ poveikio poveikį gyviems nepažeistiems gyvūnams. Naudodami šį modelį parodome, kad laukinio tipo Aβ poveikis42 (bet ne Aβ42 Gly 37 Leu) sukelia nuo rūgšties sfingomielinazės priklausomą endocitozę, kuri lygiagrečiai reaguoja į žinomą poras formuojantį toksiną CRY5B. Mes nustatėme, kad šis atsakas į Aβ priklauso nuo kalpaino ir jį keičia funkcijos praradimo mutacijos C. elegans BIN1 ir PICALM ortologai, du Alzheimerio rizikos genai, nustatyti genomo masto asociacijos tyrimuose [61, 84]. Hipokampo kultūrose parodome, kad SLO poras formuojantis toksinas pirminiuose neuronuose sukelia nuo kalpaino priklausomą tau fosforilinimą. Be to, pati egzogeninė sfingomielinazė gali sukelti padidėjusį tau fosforilinimą šiuose neuronuose. Galiausiai, mes naudojame naują žymėjimo metodą, kad parodytume, kad Gly 37 Leu pakaitalas slopina Aβ multimerizaciją ląstelių kontekste, taip racionalizuodamas, kodėl šis Aβ variantas nesugeba sukelti membranos atstatymo ar tau fosforilinimo. Visi šie rezultatai patvirtina nuomonę, kad tau hiperfosforilinimas gali būti membranos atstatymo proceso pasekmė ir kad egzogeninis Aβ gali sukelti membranos taisymą dėl savo gebėjimo oligomerizuotis į membranos poras.


Abstraktus

Daugėja įrodymų, kad tam tikra ląstelių membranų glikolipidų klasė, gangliozidai, gali tarpininkauti Alzheimerio ligos amiloido-β peptido (Aβ) fibrilogenezei ir toksiškumui. Naudodami lipidų monosluoksnius ir pūsleles kaip modelio membranas, išmatavome Aβ įterpimą į 1,2-dipalmitoil-sn-glicero-3-fosfocholino (DPPC) - gangliozido GM1 monosluoksniai zondui Aβ−GM1 sąveikos, vaizdavo Aβ įterpimo poveikį vienasluoksnei morfologijai ir matavo Aβ fibrilių susidarymo greitį, kai inkubuojamas su 1-palmitoil-2-oleoil-sn-glicero-3-fosfocholinas (POPC)-GM1 pūslelės. Be to, Aβ asociacijos vieta viename sluoksnyje buvo įvertinta dviejų zondų fluorescencijos eksperimentais. Aβ parodė tiesioginę ir palankią sąveiką su GM1 nes Aβ įterpimas monotoniškai padidėjo kartu su GM1 koncentracija, nepaisant padidėjusio vieno sluoksnio standumo esant žemam GM1 lygius. Esant žemai GM1 koncentracijos, Aβ pirmiausia įterpiamas į netvarkingą, skystą išsiplėtusią fazę. Aukštesnėje GM1 koncentracijos, Aβ tolygiau įterpiamas į monosluoksnį, todėl nėra aptinkamų pirmenybių nei netvarkingai, nei kondensuotai fazei. Aβ įterpimas lėmė membranos morfologijos sutrikimą, ypač netvarkingos fazės išsiplėtimą esant žemam GM1 koncentracijos ir reikšmingas kondensuotų domenų sutrikimas aukštesniame GM1 koncentracijos. Inkubuojant su POPC pūslelėmis, turinčiomis fiziologinius GM1, Aβ susiejimas su pūslelėmis paskatino Aβ fibrilių susidarymą. Apibendrinant galima pasakyti, kad palanki sąveika tarp Aβ ir GM1 ląstelės membranoje gali būti Aβ fibrilogenezės mechanizmas in vivo, o Aβ sukeltas ląstelės membranos sutrikimas gali būti būdas, kuriuo Aβ daro toksiškumą.

Šį darbą palaikė Alzheimerio asociacija (IIRG-9901175) ir Amerikos sveikatos pagalbos fondas (A1999057). Eksperimentinis aparatas buvo įmanomas pasinaudojus Nacionalinio mokslo fondo chemijos tyrimų instrumentų ir įrenginių programos jaunesniojo fakulteto stipendija (CHE-9816513). E.Y.C. buvo remiama Nacionalinių sveikatos institutų Ruth L. Kirschstein nacionalinės tyrimų tarnybos apdovanojimo individuali stipendija (AG025649). S.L.F. yra dėkingas už paramą Nacionalinio mokslo fondo absolventų mokslinių tyrimų stipendijai.

Kam turėtų būti adresuojami susirašinėjimai. Telefonas: (773) 702-7068. Faksas: (773) 702-0805. El. paštas: [email protected]


Multimerizacija, branduolių susidarymas ir nusodinimas

Aβ surinkimas į multimerines struktūras yra esminis šių rūšių biologinio poveikio veiksnys. Yra dvi surinkimo fazės, kurios turi skirtingas charakteristikas ir lemia skirtingas biologines savybes turinčius mazgus. Pradinis darbas su Aβ buvo sutelktas į histologinius AD požymius, amorfines ir fibrilines peptido nuosėdas. Šiuo metu dėmesys sutelkiamas į ankstesnę Aβ surinkimo fazę, kurioje dalyvauja tirpūs peptido multimerai. Šios struktūros yra daug toksiškesnės skirtingų tipų ląstelėms nei fibrilės ir sukelia skirtingą toksinių įvykių rinkinį [90]. Jie taip pat skiriasi morfologiškai ir konformaciniu požiūriu. Oligomerams specifiniai konformaciniai antikūnai neatpažįsta monomerų ar fibrilių, o fibrilėms specifiniai antikūnai neatpažįsta tirpių oligomerų. Nors šiuo metu visiškas fibrilių įtraukimo į AD atsisakymas tikriausiai yra per anksti, atsižvelgiant į anksčiau aptartą PIB istoriją ir galimą apnašų įsitraukimą į oligomerų populiacijas [91], Aβ lauko dėmesys buvo perkeltas į tirpius oligomerus.

Oligomerai lengvai susidaro iš Aβ(1-42) peptido, ne taip gerai iš gausesnio Aβ(1-40) [92]. Yra glaudus ryšys tarp 42/40 santykio ir ligos pradžios amžiaus sergant šeiminiu AD [93]. Aβ(1-42) C galas yra labai svarbus oligomerų susidarymui. Bitanas ir kt. [94] apibrėžė kai kuriuos skirtingų etapų struktūrinius parametrus in vitro oligomerų surinkimas su sintetiniais peptidais, mutavusiais tame regione. Nors ankstyvieji tarpiniai produktai sintetinio peptido oligomerizacijos metu yra nestabilūs ir reikalauja fotocheminio tarpinių produktų gaudymo, stabilūs maži oligomerai gali būti išskirti iš biologinių sistemų. Šio stabilumo skirtumo paaiškinimas nežinomas. Įrodyta, kad Aβ oligomerai, kurių SDS stabilios struktūros yra tokios mažos kaip dimerai, išskirti iš AD smegenų ir CSF, sutrikdo sinapsinę elektrofiziologiją [95, 96]. Nesvarbu, ar šie tarpiniai produktai atsiranda surinkimo metu, ar po išmontavimo in vivo, dar reikia nustatyti. Tirpūs sintetiniai Aβ oligomerai yra labai polimorfiški, jų dydžiai yra stabilūs, kurie priklauso nuo paruošimo būdo [97]. Nors tyrėjai sutinka, kad tirpūs oligomerai yra biologiškai aktyvūs ir tam tikromis sąlygomis gali sukelti ląstelių mirtį, tirpių oligomerų veikimo būdas taip pat turi būti nustatytas. Pastebimas receptorių sukeliamas poveikis [98, 99], taip pat tiesioginis oligomerų aktyvumas ant membranos dvigubo sluoksnio, ypač esant didelėms (μM) koncentracijoms, kurios gali atsirasti dėl jų paviršiaus aktyvumo. Tirpių oligomerų koncentracija CSF arba smegenų intersticiniame skystyje yra pM intervale [100].

Fibrilių susidarymas tiriamas esant didelėms monomerinio sintetinio peptido mikromolinėms koncentracijoms, siekiant padidinti fibrilės branduolio susidarymo tikimybę. Yra įrodymų [101], kad tirpių oligomerų susidarymo ir fibrilių susidarymo būdai gali būti skirtingi, nors mechaniškai abu procesai turi pereiti multimerinius etapus. Kadangi Aβ koncentracija smegenų intersticiniame skystyje yra mažiausiai trimis dydžiais mažesnė nei fibrilių formavimo tyrimuose, tikėtina, kad fibrilės susidaro branduoliuose ant ekstraląstelinės matricos arba ląstelių paviršių. Fibrilių augimas tiek ant sintetinių, tiek ant jau egzistuojančių AD smegenų fibrilių linijiškai priklauso nuo Aβ monomero koncentracijos [102] ir yra labai specifinis amiloidinės fibrilės formai [103]. Procesas yra grįžtamas in vivo transgeniniuose pelių modeliuose, stebimuose daugiafotonine mikroskopija [104], ir yra stebėtinai greitas toje sistemoje ir apima kraujagyslių amiloidą [105]. Nors šis procesas nebuvo užfiksuotas gyvose žmogaus smegenyse, aktyvaus ir pasyvaus antikūnų skyrimo gyvūnų modeliuose poveikis [106] ir žmogaus imunizacijos tyrimai [2] rodo, kad Aβ nuosėdos smegenyse bus pusiausvyroje su tarpląsteliniais antikūnais. Aβ. Taip pat yra įrodymų, patvirtinančių, kad netirpios Aβ nuosėdos yra tirpių oligomerų rezervuaras [91]. Ne visi Aβ telkiniai žmogaus smegenyse gali dalyvauti šiame greitame monomerų mainuose, o santykinis skirtingų telkinių dalyvavimas patologiniame procese nežinomas.


Metodai

Dalyviai

Šis tyrimas buvo Korėjos smegenų senėjimo tyrimo, skirto ankstyvai Alzheimerio ligos diagnostikai ir prognozavimui, dalis. Tai vyksta 2014 m. kūno pokyčiai prisideda prie smegenų pokyčių, susijusių su AD. Šiame tyrime buvo išanalizuoti 414 asmenų, nesergančių demencija (280 kognityviai normalių [CN] asmenų ir 134 asmenų su lengvu kognityviniu sutrikimu [MCI]) duomenys nuo 56 iki 90 metų (amžiaus vidurkis 70,9 ± standartinis nuokrypis 7,8 vyro, n [%] = 180 [43,5]), kurie buvo įdarbinti 2016 m. lapkričio 30 d. Dalyviai buvo įdarbinti per 4 įdarbinimo vietas Seule, Pietų Korėjoje. Potencialiai tinkami asmenys, kurie dalyvavo demencijos patikros programoje 2 viešuosiuose demencijos prevencijos ir valdymo centruose arba lankėsi atminties klinikose 2 universitetinėse ligoninėse (ty Seulo nacionalinėje universitetinėje ligoninėje ir SNU-SMG Boramae medicinos centre) Seule, Pietų Korėjoje, buvo informuoti. apie dalyvavimą studijose, o savanoriškieji buvo pakviesti įvertinti tinkamumą. Be to, savanoriai iš bendruomenės buvo įdarbinti per skelbimus internete, plakatus ir brošiūras pagrindinėse įdarbinimo svetainėse ir iš lūpų į lūpas (rekomenduoja kiti dalyviai, šeimos nariai, draugai ar pažįstami). Išsamesnė informacija apie KBASE tyrimo charakteristikas, įskaitant įdarbinimą, buvo paskelbta anksčiau [35]. CN grupę sudarė dalyviai, kurių klinikinis demencijos įvertinimas (CDR) [36] buvo 0 ir nebuvo diagnozuota MCI ar demencija. Visi asmenys, sergantys MCI, atitiko dabartinius amnestinio MCI sutarimo kriterijus, kurie yra tokie: (1) informatoriaus patvirtinti atminties sutrikimai, (2) objektyvūs atminties sutrikimai, (3) išsaugota visuotinė pažinimo funkcija, (4) funkcinės veiklos nepriklausomumas. ir (5) neserga demencija. Dėl 2 kriterijaus, pagal amžių, išsilavinimą ir lytį z-balai bent 1 iš 4 epizodinės atminties testų buvo <-1,0. 4 atminties testai buvo žodžių sąrašo atminties, žodžių sąrašo atkūrimo, žodžių sąrašo atpažinimo ir konstrukcinio atšaukimo testai, kurie yra įtraukti į Alzheimerio ligos registro konsorciumo (CERAD-K) neuropsichologinio įvertinimo bateriją korėjiečių kalba [37]. ]. Visų asmenų, sergančių MCI, CDR balas buvo 0,5.

Išskyrimo kriterijai buvo tokie: 1) sunkios psichikos ligos, įskaitant su alkoholiu susijusius sutrikimus, buvimas; 2) reikšmingos neurologinės ar medicininės būklės arba gretutinės ligos, galinčios turėti įtakos psichinei funkcijai; 3) kontraindikacijos atlikti MRT tyrimą (pvz., širdies stimuliatorius arba klaustrofobija);

Tyrimo protokolą patvirtino Seulo nacionalinės universitetinės ligoninės (C-1401-027-547) ir SNU-SMG Boramae medicinos centro (26-2015-60), Seulas, Pietų Korėja, institucinės peržiūros tarybos, o tyrimas buvo atliktas m. pagal dabartinės Helsinkio deklaracijos redakcijos rekomendacijas. Dalyviai arba jų teisėti atstovai davė raštišką informuotą sutikimą.

Klinikiniai vertinimai

Visiems dalyviams buvo atlikti išsamūs klinikiniai ir neuropsichologiniai vertinimai, kuriuos atliko apmokyti psichiatrai ir neuropsichologai, remiantis KBASE vertinimo protokolu [35], kuriame yra CERAD-K neuropsichologinio vertinimo baterija [38, 39].

Alkoholio suvartojimo įvertinimas

Visus dalyvius sistemingai apklausė apmokytos slaugytojos, kad nustatytų alkoholio vartojimą, naudojant interviu formą (S1 interviu forma) medicinos mokslo pastate Seulo nacionalinio universiteto medicinos miestelyje, Seule, Pietų Korėjoje. Remiantis Pasaulio sveikatos organizacijos gairėmis [40], 1 standartinis gėrimas (SD) buvo apibrėžiamas kaip bet koks gėrimas, kuriame yra 10 gramų gryno alkoholio. Kadangi alkoholinių gėrimų ir prekių ženklų yra daug įvairių, skirtingi gėrimai buvo suskirstyti taip: 1 skardinė alaus (4,5 % alkoholio 330 ml) = 1 SD 1 butelis alaus (4,5 % alkoholio 640 ml) = 2 SD, 1 butelis vietinio korėjietiško spirito (20 % alkoholio 360 ml) = 6 SD, 1 butelis spirito (40 % alkoholio 750 ml) = 24 SD, 1 butelis korėjietiško tradicinio vyno (8 % alkoholio 900 ml) = 6 SD ir 1 butelis vyno (12 % alkoholio 900 ml) = 9 SD. Be to, kiekvieno dalyvio alkoholio vartojimo modeliai buvo suskirstyti į tokias kategorijas: gėrimo būsena (negeriantis, buvęs gėrėjas, geriantis) ir alkoholio vartojimo dažnumas bei kiekis (SD per gėrimo dieną, gėrimo dienos per savaitę, SD per savaitę). praėjusius metus (dabartinį) ir visą gyvenimą. Tie, kurie per praėjusius metus išgėrė daugiau nei 6 SD per dieną, buvo klasifikuojami kaip besaikis alkoholio vartotojai [10]. Tarp dabartinių negeriančių asmenų, kurie anksčiau gėrė reguliariai, bet per pastaruosius metus nevartojo alkoholio, buvo priskirti prie buvusių geriančių asmenų [5,11]. Ankstesni epidemiologiniai alkoholio vartojimo poveikio tyrimai parodė, kad buvo aiškus bendros arba AD demencijos rizikos skirtumas tarp negėrusių (referencinis), anksčiau gėrusių, nestipriai gėrusių, saikingai geriančių ir daug geriančių grupių [11,22,41 ]. Remiantis šiomis ataskaitomis, mūsų dalyviai buvo suskirstyti į kategorijas pagal savaitės suvartojamo alkoholio kiekį taip: negėrė (referencinė kategorija), anksčiau gėrė, <1 SD per savaitę (<10 gramų per savaitę lengvas gėrimas), 1–13 SD per savaitę (10–130). gramų per savaitę saikingas gėrimas) ir 14+ SD per savaitę (≥140 gramų per savaitę nesaugus gėrimas pagal naujai peržiūrėtas JK sveikatos departamento rekomendacijas [42]).

Galimų trikdžių įvertinimas

Alkoholio vartojimui gali turėti įtakos įvairios kitos sąlygos. Todėl visi dalyviai buvo sistemingai vertinami dėl galimų trikdžių, tokių kaip depresija, kraujagyslių rizika, kūno svoris, kūno masės indeksas (KMI), profesinis sudėtingumas, metinės pajamos ir apolipoproteino E (APOE) genotipų nustatymas. Depresijai įvertinti buvo naudojama geriatrinės depresijos skalė (GDS) [43]. Kūno svoris, ūgis ir gretutinių kraujagyslių rizikos veiksnių (įskaitant hipertenziją, cukrinį diabetą, dislipidemiją, koronarinę širdies ligą, praeinantį išemijos priepuolį ir insultą) dažnis buvo įvertintas remiantis duomenimis, kuriuos surinko apmokytos slaugytojos sistemingų dalyvių ir jų informatorių KMI interviu metu. buvo apskaičiuotas svorį kilogramais padalijus iš ūgio metrais kvadrato, o kraujagyslių rizikos balas buvo apskaičiuotas pagal kraujagyslių rizikos veiksnių skaičių [44]. Atsižvelgdami į profesijos sudėtingumą, mes atsižvelgėme tik į ilgiausiai užimtą profesiją, suskirstytą į 4 lygius pagal įgūdžių lygius, aprašytus Tarptautinėje standartinėje profesijų klasifikacijoje [45]. 1 įgūdžių lygio profesijos paprastai apima paprastas ir įprastas fizines arba rankines užduotis. 2 įgūdžių lygio profesijos apima tokias užduotis kaip mechanizmų ir elektroninės įrangos valdymas, transporto priemonių vairavimas, elektros ir mechaninės įrangos priežiūra ir remontas, informacijos manipuliavimas, užsakymas ir saugojimas. 3 įgūdžių lygio profesijos apima sudėtingų techninių ir praktinių užduočių, kurioms reikia sudėtingo problemų sprendimo, samprotavimo ir sprendimų priėmimo specializuotoje srityje, atlikimą. 4 įgūdžių lygio profesijos apima užduočių, kurioms reikalingas sudėtingas problemų sprendimas, sprendimų priėmimas ir kūrybiškumas, pagrįstos daugybe teorinių ir faktinių žinių specializuotoje srityje, atlikimą. Informacija apie profesiją buvo gauta iš dalyvių savarankiško pranešimo ir patvirtinta patikimų informatorių. Metinės pajamos buvo įvertintos ir suskirstytos į 3 grupes (žemesnės už minimalias pragyvenimo išlaidas [MCL], mažesnės nei MCL, bet mažesnės nei dvigubai MCL, dvigubai didesnės už MCL ar daugiau http://www.law.go.kr). MCL buvo nustatytas pagal administracinę taisyklę, kurią 2012 m. lapkričio mėn. paskelbė Korėjos Respublikos Sveikatos ir gerovės ministerija. MCL buvo 572 168 Korėjos vonai (KRW) (atitinka 507,9 USD) vienam asmeniui ir pridėta 286 840 KRW (atitinka 254,6 USD) už kiekvieną papildomą namų ūkio narį. Kraujo mėginiai buvo paimti atliekant venipunkciją, genominė DNR buvo išskirta iš viso kraujo, o APOE genotipas buvo atliktas, kaip aprašyta anksčiau [46]. apolipoproteino ε4 (APOE4) pozityvumas buvo užkoduotas, jei buvo bent 1 ε4 alelis.

Smegenų Aβ nusėdimo matavimas

Visiems dalyviams vienu metu buvo atlikti 3D PiB PET ir 3D T1 svertiniai MRT skenavimai naudojant 3.0T Biograph mMR (PET-MR) skaitytuvą (Siemens) pagal gamintojo gaires, PiB PET vaizdų gavimo ir išankstinio apdorojimo informacija pateikta S1 metodu. Norint nustatyti dominančius regionus (ROI), apibūdinti PiB sulaikymo lygius priekinėje, šoninėje parietalinėje, užpakalinėje cingulate / prekuneus ir šoninėje laiko srityse, buvo pritaikytas automatinio anatominio žymėjimo algoritmas ir regionų sujungimo metodas [47]. Kiekvienos ROI standartizuotos įsisavinimo vertės santykio (SUVR) vertės buvo apskaičiuotos padalijus visų kiekvienos ROI vokselių vidutinę vertę iš vidutinės smegenėlių įsisavinimo vertės tame pačiame vaizde. Taip pat buvo apibrėžta pasaulinė žievės ROI, susidedanti iš 4 ROI, o visuotinė Aβ sulaikymo vertė buvo sukurta padalijus vidutinę visų pasaulinės žievės ROI vokselių vertę iš vidutinės smegenėlių įsisavinimo vertės tame pačiame vaizde [47, 48]. Dalyviai buvo klasifikuojami kaip Aβ+, jei pasaulinis Aβ sulaikymas buvo >1,21, ir kaip Aβ−, jei pasaulinis Aβ sulaikymas buvo ≤1,21 [49].

AD parašo neurodegeneracijos matavimas

Visiems dalyviams buvo atliktas FDG PET vaizdavimas naudojant aukščiau minėtą PET-MR skaitytuvą, FDG PET vaizdo gavimo ir išankstinio apdorojimo detalės pateikta S1 metodu. Buvo nustatytos AD parašo FDG ROI, pvz., kampinis girias, užpakalinė cingulinė žievė ir apatinė laikinoji žievė, jautrios su AD susijusiems pokyčiams [50]. AD parašo smegenų gliukozės metabolizmas (AD-CM) buvo apibrėžtas kaip vokselių svertinis vidutinis SUVR, išgautas iš AD parašo FDG ROI. MRT gavimo ir išankstinio apdorojimo detalės yra pateiktos S1 metodu. AD-signato žievės storis (AD-CT) buvo apibrėžtas kaip vidutinės žievės storio vertės, gautos iš AD parašo regionų, įskaitant entorhinalinį, apatinį laikiną, vidurinį temporalinį ir fusiforminį gyrus regionus, kaip aprašyta anksčiau [50].

WMH matavimas

Visiems dalyviams buvo atliktas MRT skenavimas naudojant skysčių susilpnintą inversijos atkūrimą (FLAIR), naudojant pirmiau minėtą 3.0T PET-MR skaitytuvą. Išsami informacija apie smegenų WMH tūrio matavimus pateikta S1 metodu.

Statistinė analizė

Norėdami patikrinti hipotetinius ryšius tarp vidutinio alkoholio vartojimo ir neurovaizdinių biomarkerių bei ištirti ryšį tarp kitų alkoholio vartojimo kategorijų ir biomarkerių, planavome atlikti keletą regresijos analizių, kaip nurodyta toliau. Pirma, daugialypės logistinės regresijos analizės, kurių nepriklausomas kintamasis yra visą gyvenimą (arba dabartinė) alkoholio vartojimo kategorija (ty negerti, <1 SD per savaitę, 1–13 SD per savaitę ir 14+ SD per savaitę) kaip nepriklausomas kintamasis ir Aβ teigiamas rodiklis. buvo atlikti kintamieji. Šiose analizėse, siekiant palyginti alkoholio vartojimo poveikį, palyginti su negėrimu, joks gėrimas nebuvo naudojamas kaip atskaitos taškas (ty negėrimas, palyginti su <1 SD per savaitę, negėrimas, palyginti su 1–13 SD per savaitę arba negėrimas, palyginti su 14+ SD per savaitę) kiekviename modelyje. Buvo išbandyti trys modeliai, laipsniškai kontroliuojant galimus trikdžius, galinčius turėti įtakos alkoholio vartojimo ir AD biomarkerių ryšiui. Pirmasis modelis (1 modelis) neapėmė jokių kovariacijų, antrasis modelis (2 modelis) apėmė amžių, lytį, APOE4, kraujagyslių rizikos balą ir GDS balą kaip kovariatorius, o trečiasis modelis (3 modelis) įtraukė kovariatorius į antrąjį modelį. plius išsilavinimas (vidurinis arba žemesnis, palyginti su aukštesniu nei vidurinis išsilavinimas), klinikinė diagnozė (CN ir MCI), profesinis sudėtingumas, metinės pajamos, kūno svoris ir KMI [51]. Antra, buvo atliktos kelios linijinės regresijos analizės, siekiant palyginti pasaulinio Aβ sulaikymo, AD-CM, AD-CT ir WMH skirtumus tarp viso gyvenimo (arba dabartinių) alkoholio vartojimo grupių, kontroliuojant tuos pačius kovariatorius. Atliekant analizę, visuotinis Aβ sulaikymas buvo naudojamas po natūralios log-transformacijos, kad būtų pasiektas normalus pasiskirstymas.

Atlikdami jautrumo analizę, mes taip pat atlikome tokias pačias analizes, išbraukę besaikius gėrimus iš visą gyvenimą arba dabar geriančius, kad sumažintume besaikio gėrimo modelio įtaką alkoholio vartojimo dažnumo ir kiekio bei neurovaizdinių kintamųjų ryšiui. Be to, tą pačią analizę atlikome išskyrę buvusius geriančius asmenis iš dabartinių negeriančių žmonių, kad sumažintume galimą priverstinių abstinentų, kurie nustojo vartoti alkoholį dėl kitų sveikatos problemų, susijusių su probleminiu girtavimu, padarinius.

Siekiant ištirti amžiaus (jaunesnio [<75 metų] ir vyresnio [≥75 metų]) [52], lyties (moteris ir vyro), APOE4 (APOE4+ ir APOE4−) ir klinikinės diagnozės (CN ir MCI) įtaką] on the association between alcohol intake and neuroimaging biomarkers that were significant in the analyses described above, the same regression analysis was repeated including a 2-way interaction term between alcohol intake and each of the 4 neuroimaging biomarkers as an additional independent variable.

All statistical analyses were performed using IBM SPSS Statistics 24.


Įvadas

Genetic, biochemical, and animal model studies strongly suggest a central role for amyloid-β (Αβ) in the pathogenesis of Alzheimer's disease (AD) (Sisodia, 1999 Golde et al., 2000 St. George-Hyslop, 2000 Selkoe, 2001). Aβ is a 38-43 amino acid peptide derived from the amyloid precursor protein (APP). Early-onset forms of familial, autosomal dominant AD appear to be attributable to an overproduction of a more amyloidogenic form of Aβ (Aβ42), resulting in conversion of Aβ, in early adult life, from soluble, nontoxic forms to both soluble and insoluble toxic forms with a high β-sheet content (Tanzi et al., 1996). In contrast, the most common form of AD (late-onset, age >60) does not appear to result from Aβ overproduction. Instead, other genetic [e.g., APOE (apolipoprotein E) allelic differences] and nongenetic factors appear to be important in determining whether and when Aβ conformational changes occur (Wisniewski et al., 1997 Teplow, 1998 Holtzman, 2001). Thus, understanding not only mechanisms of Aβ production but also factors that control Aβ metabolism are likely to be critical for understanding AD pathogenesis, as well as for developing better diagnostic and treatment methods.

A major pathologic hallmark of AD is the deposition of the normally soluble Aβ peptide into aggregated, extracellular structures called plaques (Price et al., 1998 Selkoe, 2001). Although it is not proven whether the seed, or nidus, of plaques originates extracellularly or intracellularly, recent evidence suggests that initial formation and growth of plaques can occur extracellularly (Meyer-Luehmann et al., 2003). Regardless of where plaques originate, it is likely that the subsequent Aβ building blocks for plaques are derived from the brain interstitial fluid (ISF). Aβ appears to be released from neurons into the extracellular space normally via synaptic activity (Kamenetz et al., 2003). Assessment of the ISF pool of Aβ may provide unique insights into the regulation of Aβ metabolism, Aβ aggregation, and plaque formation. To date, however, there have been no methods that have permitted analysis of ISF Aβ.

To this end, we developed an in vivo microdialysis technique to measure ISF Aβ in awake, APP transgenic mice that develop age-dependent Aβ aggregation and deposition (PDAPP mice) (Games et al., 1995). We compared the steady-state concentrations of several Aβ species in the ISF of 3-month-old and 12- to 15-month-old PDAPP mice to those species within the CSF and tissue. These studies show that the development of Aβ deposition is associated with changes in ISF Aβ levels and ratios that differ in relation to tissue lysates and CSF. By combining our microdialysis technique with a potent γ-secretase inhibitor, we also demonstrate that the half-life of ISF Aβ is short and is markedly influenced by the presence of Aβ deposition. This strongly suggests that rapid inhibition of Aβ production in vivo reveals an equilibrium between soluble and part of the insoluble pool of Aβ. This rapidly dissociable, now measurable pool of Aβ may provide new ways to diagnose the presence of Aβ deposits and is likely to be the target of various anti-Aβ treatments.


Nuorodos

Arriagada PV, Growdon JH, Hedley-Whyte ET, Hyman BT (1992) Neurofibrillary tangles but not senile plaques parallel duration and severity of Alzheimer’s disease. Neurology 42:631–639

Bolmont T, Clavaguera F, Meyer-Luehmann M, Herzig MC, Radde R, Staufenbiel M, Lewis J, Hutton M, Tolnay M, Jucker M (2007) Induction of tau pathology by intracerebral infusion of amyloid-beta -containing brain extract and by amyloid-beta deposition in APP x Tau transgenic mice. Am J Pathol 171:2012–2020

Braak H, Thal DR, Ghebremedhin E, Del Tredici K (2011) Stages of the pathologic process in Alzheimer disease: age categories from 1 to 100 years. J Neuropathol Exp Neurol 70:960–969

Brendza RP, Bacskai BJ, Cirrito JR, Simmons KA, Skoch JM, Klunk WE, Mathis CA, Bales KR, Paul SM, Hyman BT, Holtzman DM (2005) Anti-Abeta antibody treatment promotes the rapid recovery of amyloid-associated neuritic dystrophy in PDAPP transgenic mice. J Clin Invest 115:428–433

Chetelat G (2013) Alzheimer disease: Abeta-independent processes-rethinking preclinical AD. Nat Rev Neurol 9:123–124

de Calignon A, Polydoro M, Suarez-Calvet M, William C, Adamowicz DH, Kopeikina KJ, Pitstick R, Sahara N, Ashe KH, Carlson GA, Spires-Jones TL, Hyman BT (2012) Propagation of tau pathology in a model of early Alzheimer’s disease. Neuron 73:685–697

Geneser-Jensen FA, Blackstad TW (1971) Distribution of acetyl cholinesterase in the hippocampal region of the guinea pig. I. Entorhinal area, parasubiculum, and presubiculum. Z Zellforsch Mikrosk Anat 114:460–481

Gotz J, Chen F, van Dorpe J, Nitsch RM (2001) Formation of neurofibrillary tangles in P301l tau transgenic mice induced by Abeta 42 fibrils. Science 293:1491–1495

Hardy JA, Higgins GA (1992) Alzheimer’s disease: the amyloid cascade hypothesis. Science 256:184–185

Harris JA, Koyama A, Maeda S, Ho K, Devidze N, Dubal DB, Yu GQ, Masliah E, Mucke L (2012) Human P301L-mutant tau expression in mouse entorhinal-hippocampal network causes tau aggregation and presynaptic pathology but no cognitive deficits. PLoS One 7:e45881

Hyman BT, Van Hoesen GW, Damasio AR, Barnes CL (1984) Alzheimer’s disease: cell-specific pathology isolates the hippocampal formation. Science 225:1168–1170

Ingelsson M, Fukumoto H, Newell KL, Growdon JH, Hedley-Whyte ET, Frosch MP, Albert MS, Hyman BT, Irizarry MC (2004) Early Abeta accumulation and progressive synaptic loss, gliosis, and tangle formation in AD brain. Neurology 62:925–931

Jack CR Jr, Knopman DS, Jagust WJ, Petersen RC, Weiner MW, Aisen PS, Shaw LM, Vemuri P, Wiste HJ, Weigand SD, Lesnick TG, Pankratz VS, Donohue MC, Trojanowski JQ (2013) Tracking pathophysiological processes in Alzheimer’s disease: an updated hypothetical model of dynamic biomarkers. Lancet Neurol 12:207–216

Jellinger K, Braak H, Braak E, Fischer P (1991) Alzheimer lesions in the entorhinal region and isocortex in Parkinson’s and Alzheimer’s diseases. Ann N Y Acad Sci 640:203–209

Kovacs GG, Milenkovic I, Wohrer A, Hoftberger R, Gelpi E, Haberler C, Honigschnabl S, Reiner-Concin A, Heinzl H, Jungwirth S, Krampla W, Fischer P, Budka H (2013) Non-Alzheimer neurodegenerative pathologies and their combinations are more frequent than commonly believed in the elderly brain: a community-based autopsy series. Acta Neuropathol 126:365–384

Liu L, Drouet V, Wu JW, Witter MP, Small SA, Clelland C, Duff K (2012) Trans-synaptic spread of tau pathology in vivo. PLoS One 7:e31302

Lynch GS, Lucas PA, Deadwyler SA (1972) The demonstration of acetylcholinesterase containing neurones within the caudate nucleus of the rat. Brain Res 45:617–621

Manaye KF, Wang PC, O’Neil JN, Huang SY, Xu T, Lei DL, Tizabi Y, Ottinger MA, Ingram DK, Mouton PR (2007) Neuropathological quantification of dtg APP/PS1: neuroimaging, stereology, and biochemistry. Age 29:87–96

McKee AC, Kosik KS, Kowall NW (1991) Neuritic pathology and dementia in Alzheimer’s disease. Ann Neurol 30:156–165

Polydoro M, de Calignon A, Suarez-Calvet M, Sanchez L, Kay KR, Nicholls SB, Roe AD, Pitstick R, Carlson GA, Gomez-Isla T, Spires-Jones TL, Hyman BT (2013) Reversal of neurofibrillary tangles and tau-associated phenotype in the rTgTauEC model of early Alzheimer’s disease. J Neurosci 33:13300–13311

Polydoro M, Dzhala VI, Pooler AM, Nicholls SB, McKinney AP, Sanchez L, Pitstick R, Carlson GA, Staley KJ, Spires-Jones TL, Hyman BT (2013) Soluble pathological tau in the entorhinal cortex leads to presynaptic deficits in an early Alzheimer’s disease model. Neuropathol Acta 127:257–270

Pooler AM, Phillips EC, Lau DH, Noble W, Hanger DP (2013) Physiological release of endogenous tau is stimulated by neuronal activity. EMBO Rep 14:389–394

Pooler AM, Polydoro M, Wegmann SK, Pitstick R, Kay KR, Sanchez L, Carlson GA, Gomez-Isla T, Albers MW, Spires-Jones TL, Hyman BT (2013) Tau-amyloid interactions in the rTgTauEC model of early Alzheimer’s disease suggest amyloid-induced disruption of axonal projections and exacerbated axonal pathology. J Comp Neurol 521:4236–4248

Rasool S, Martinez-Coria H, Wu JW, LaFerla F, Glabe CG (2013) Systemic vaccination with anti-oligomeric monoclonal antibodies improves cognitive function by reducing Abeta deposition and tau pathology in 3xTg-AD mice. J Neurochem 126:473–482

Ribe EM, Perez M, Puig B, Gich I, Lim F, Cuadrado M, Sesma T, Catena S, Sanchez B, Nieto M, Gomez-Ramos P, Moran MA, Cabodevilla F, Samaranch L, Ortiz L, Perez A, Ferrer I, Avila J, Gomez-Isla T (2005) Accelerated amyloid deposition, neurofibrillary degeneration and neuronal loss in double mutant APP/tau transgenic mice. Neurobiol Dis 20:814–822

Santacruz K, Lewis J, Spires T, Paulson J, Kotilinek L, Ingelsson M, Guimaraes A, DeTure M, Ramsden M, McGowan E, Forster C, Yue M, Orne J, Janus C, Mariash A, Kuskowski M, Hyman B, Hutton M, Ashe KH (2005) Tau suppression in a neurodegenerative mouse model improves memory function. Science 309:476–481

Thal DR, Rub U, Orantes M, Braak H (2002) Phases of A beta-deposition in the human brain and its relevance for the development of AD. Neurology 58:1791–1800

Wu JW, Herman M, Liu L, Simoes S, Acker CM, Figueroa H, Steinberg JI, Margittai M, Kayed R, Zurzolo C, Di Paolo G, Duff KE (2013) Small misfolded Tau species are internalized via bulk endocytosis and anterogradely and retrogradely transported in neurons. J Biol Chem 288:1856–1870

Yamada K, Holth JK, Liao F, Stewart FR, Mahan TE, Jiang H, Cirrito JR, Patel TK, Hochgrafe K, Mandelkow EM, Holtzman DM (2014) Neuronal activity regulates extracellular tau in vivo. J Exp Med 211:387–393


Prieiga prie dokumento

  • APA
  • Autorius
  • BIBTEX
  • Harvardas
  • Standartinis
  • UIP
  • Vankuveris

Research output : Contribution to journal › Review article › peer-review

T1 - In vivo effects of ApoE and clusterin on amyloid-beta metabolism and neuropathology.

N2 - The epsilon4 allele of apolipoprotein E APOE is a risk factor for Alzheimer's disease (AD) and cerebral amyloid angiopathy (CAA), and the epsilon2 allele is associated with a decreased risk for AD. There is strong evidence to suggest that a major, if not the main, mechanism underlying the link between apoE and both AD and CAA is related to the ability of apoE to interact with the amyloid-beta (Abeta) peptide and influence its clearance, aggregation, and conformation. In addition to a number of in vitro studies supporting this concept, in vivo studies with amyloid precursor protein (APP) transgenic mice indicate that apoE and a related molecule, clusterin (also called apolipoprotein J), have profound effects on the onset of Abeta deposition, as well as the local toxicity associated with Abeta deposits both in the brain parenchyma and in cerebral blood vessels. Taken together, these studies suggest that altering the expression of apoE and clusterin in the brain or the interactions between these molecules and Abeta would alter AD pathogenesis and provide new therapeutic avenues for prevention or treatment of CAA and AD.

AB - The epsilon4 allele of apolipoprotein E APOE is a risk factor for Alzheimer's disease (AD) and cerebral amyloid angiopathy (CAA), and the epsilon2 allele is associated with a decreased risk for AD. There is strong evidence to suggest that a major, if not the main, mechanism underlying the link between apoE and both AD and CAA is related to the ability of apoE to interact with the amyloid-beta (Abeta) peptide and influence its clearance, aggregation, and conformation. In addition to a number of in vitro studies supporting this concept, in vivo studies with amyloid precursor protein (APP) transgenic mice indicate that apoE and a related molecule, clusterin (also called apolipoprotein J), have profound effects on the onset of Abeta deposition, as well as the local toxicity associated with Abeta deposits both in the brain parenchyma and in cerebral blood vessels. Taken together, these studies suggest that altering the expression of apoE and clusterin in the brain or the interactions between these molecules and Abeta would alter AD pathogenesis and provide new therapeutic avenues for prevention or treatment of CAA and AD.


MEDŽIAGOS IR METODAI

Gyvūnai

B6.Cg-Tg(CAG-cre/Esr1)5Amc/J mice, which we referred to as CAG-Cre ERT2 mice, were obtained from The Jackson Laboratory (21). The B6.129S4- Meox2tm1(cre)Sor /J mice, which we referred to as Meox-Cre, were provided by M. Tallquist (24). Tg2576 mice were obtained from Taconic (38). Animals were group-housed in a standard 12-hour light cycle and fed standard mouse chow ad libitum. All animal care protocols were done in accordance with the Institutional Animal Care and Use Committee of the University of Texas Southwestern Medical Center and the University of Freiburg.

In light of the complexity of the genetic crosses and the different origins of the animal strains involved in this study, it has not been possible to conduct all experiments on a strictly homogenous C57Bl/6 strain background. To ensure a minimal effect of strain background on the behavioral results we have found, all animals that were compared were brother/sister crosses that only differ by the absence or presence of Cre recombinase. Moreover, discovering a robust response like the one discussed here in a mixed background, as opposed to an inbred one, further strengthens the validity of the conclusions, rather than diminishing them. It also further supports the applicability of the results to the even more genetically heterogeneous human population.

Karta Reln flox/flox pelė

To create the targeting vector for the Reelin cKO mouse line, pJB1 [described in (69)] was used as background vector, and murine SV129J embryonic stem (ES) cell DNA was used as template DNA to amplify the short homology arm (SA 1.35 kb), the fragment containing the first exon (EX1 1.25 kb), and the long homology arm (LA 9 kb). To incorporate the first loxP site, a Cla I and a Pvu I restriction site were included in the SA reverse and the EX1 forward primers, respectively. By three-fragment ligation, the (i) SA (cut with Sal I and Cla I) and (ii) EX1 (cut with Sal I and Pvu I) fragments were combined by a (iii) loxP coding linker (two annealed oligos with sticky ends for Cla I and Pvu I) and cloned between the Neo and HSVTK selection marker genes (Xho I site, compatible ends with Sal I) of pJB1. The resulting vector was opened with Not I to insert the 9-kb LA fragment 3′ downstream of the loxP/FRT-flanked neo cassette. The primers used were as follows: SA_forward, 5′- ATCGAT GTCGAC GGAAGTTTTGCTTCTTCCGGTG-3′ (Sal I) SA_reverse, 5′-CA ATCGAT GTTGTTTGTCTACGCCGGCTGCAAC-3′ (Cla I) EX1_forward, 5′-CCTTCTCG CGATCG CGCGTCCTCGCAGAACGGGCAGCC-3′ (Pvu I) EX1_reverse, 5′-GCGGCCGC GTCGAC TGGGCAGCCACCGACCAAAGTGCTC-3′ (Sal I) LA_forward, 5′-TGTT GCGGCCGC GGCGGCCAGTTAAAAGTTCCCGCTG-3′ (Not I) LA_reverse, 5′-GTCGAC GCGGCCGC TTCCATAAAAGGGAAGAGCAAGATG-3′ (Not I). The oligos used were loxP_forward, 5′- CG ATAACTTCGTATAGCATACATTATACGAAGTTAT AT -3′, and loxP_reverse, 5′- CGAT ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGAT -3′.

The final construct containing the SA-loxP-EX1-loxP-Neo-loxP-LA-HSVTK cassette was linearized and electroporated into SV129J ES cells. Gene targeting–positive ES cells [polymerase chain reaction (PCR) screen] were injected into C57Bl/6J blastocysts, resulting in chimeric mice. The chimeras were crossed to C57Bl/6J mice, resulting in Reln fl/wt mice, verified by PCR and Southern blot. Heterozygous animals were backcrossed to Meox-Cre on the BL6 background to yield germline mutant reeler pelėms. Heterozygous animals were also backcrossed to CAG- CreERT2 mice to obtain homozygous Reln fl/fl CAG-Cre pelėms. These were again backcrossed to Tg2576 mice, and offspring used in the experiments were brother/sister crossed CAG-Cre hemizygous and Tg2576 hemizygous mice. To ensure a minimal effect on the behavioral results we have found, all animals that were compared were brother/sister crosses that differed only by the absence or presence of Cre recombinase.

Tamoxifen injections

At 2 months of age, mice were given daily intraperitoneal injections for 5 days of tamoxifen (135 mg/kg Sigma) dissolved in sunflower oil. Control mice were injected with sunflower oil vehicle.

Antikūnai

The following primary antibodies were used for the described experiments: NeuN (Millipore, Mab377 1:300), NMDAR2B (Cell Signaling, 4212S 1:2000), NR2A (Cell Signaling, 4205S 1:500), GluR1 (Abcam, ab7260 1:2000), GluR2/3 (Millipore, 07-598 1:2000), β-actin (Abcam, ab8227 1:3000), G10 [(70) 1:1000 for Western blotting, 1:500 for immunohistochemistry], 6E10 (Covance, SIG-39320), 4G8 (Covance, SIG-39220), Dab1 [5091 (71) 1:1000], phospho-GSK3β (Cell Signaling, 9336S 1:3000), GSK3β (BD Transduction, 610201 1:3000), phospho-Tau (Thr 231 ) (Invitrogen, 44746G 1:5000), AT8 (Thermo, #MN1020 1:2000), Tau-5 (Invitrogen, AHB0042 1:5000), phospho-Akt (Ser 473 ) (Cell Signaling, 9271S 1:1000), Akt (Cell Signaling, 9272S 1:1000), phospho-ERK (Cell Signaling, 4370 1:1000), ERK (Cell Signaling, 4696S 1:1000), phospho-Src (Biosource, 44660 1:1000), Src (Biosource, 44-656Z 1:1000), and receptor-associated protein (RAP) (692, 1:1000). Secondary antibodies used were goat anti-mouse Alexa Fluor 488 (Molecular Probes, 1:1000, for immunohistochemistry), donkey anti-rabbit ECL, horseradish peroxidase (HRP)–linked (Amersham, NA934 1:3000), and donkey anti-mouse 800 and donkey anti-rabbit 680 (LI-COR, 1:3000, for Western blotting).

Western blotingas

Mice were deeply anesthetized with isoflurane and decapitated, and the hippocampi and cortices were rapidly dissected on ice. Tissues were immediately flash-frozen in liquid nitrogen. The tissue was homogenized in radioimmunoprecipitation assay buffer [50 mM tris (pH 8.0), 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% NP40] with protease and phosphatase inhibitors and then centrifuged at 14,000 rpm for 15 min to remove debris and nuclei. To analyze tau protein, tissues were homogenized in buffer [0.1 M MES (pH 6.8), 0.5 mM MgSO4, 1 mM EGTA, 2 mM dithiothreitol, 0.5 M NaCl, 2 mM phenylmethylsulfonyl fluoride, 20 mM sodium fluoride, 0.5 mM sodium orthovanadate, 1 mM benzamidine, 25 mM β-glycerophosphate, 10 mM p-nitrophenylphosphate, aprotinin (10 μg/ml), leupeptin (10 μg/ml), 1 μM okadaic acid] and then clarified at 14,000 rpm for 5 min at 4°C. The supernatant was boiled for 5 min in a water bath and then put on ice for 5 min the precipitated proteins were removed by centrifugation 14,000 rpm for 5 min. The supernatant was saved for analysis, as previously described (3). Protein concentration was determined using the Bio-Rad DC Protein Assay. Ten micrograms of protein was resolved on 4 to 15% Bio-Rad polyacrylamide gels and then transferred onto nitrocellulose membranes. The membranes were blocked in Odyssey (LI-COR) blocking buffer for 1 hour at room temperature and then incubated overnight in primary antibody. The membranes were protected from light and incubated with 1:3000 Odyssey secondary antibodies and then imaged on the Odyssey CLx Infrared Imaging System. Phosphorylated Src was quantified using ECL secondary antibody and developed using the SuperSignal West Femto Maximum Sensitivity Substrate because of low signal (Life Technologies). Blot quantification was performed using Image Studio software.

Behavioral characterization

All animals were allowed to acclimate in their home cage in the behavior facility for at least 1 hour before experimentation. Experiments were performed between 1400 and 1800. After completion of behavioral studies, Reelin knockout was confirmed by Western blot, and cKO mice that did not show greater than 95% reduction of Reelin in the forebrain were removed from data analysis.

Rotarod

Mice were placed on a Rotamex rotarod apparatus facing away from the experimenter. The rod was initially rotating at 2 rpm and then accelerated at a rate of 1 rpm/5 s until the mice fell off the rod or 300 s had passed. The time to falling off or the first “spin,” when the mouse completed a full rotation holding on to the rod, ended the trial. The mice received four trials per day over the course of 10 days with a 15-min inter-trial interval. The slowest of the four trials was excluded, and the remaining three trials were averaged.

Open field

Mice were individually placed in the center of a VersaMax animal activity monitor, which contained a 42 cm × 42 cm acrylic box with a small layer of bedding. Activity was measured by beam breaks over the course of 60 min in bins of 2 min each. Movement was analyzed using the VersaDat analysis software.

Elevated plus maze

Mice were placed at the center of the elevated plus maze, which consisted of two open arms and two closed arms. Mice were allowed to explore the maze for 5 min, and the time spent in each arm was scored automatically.

Prepulse inhibition

Mice were placed in an SR-LAB startle response system. After 5-min acclimation to a background 70-dB noise, the mice first received five 120-dB tones to record baseline startle. They were then given a series of pseudo-random pairings of a 120-dB tone immediately preceded by a 0-, 74-, 78-, or 86-dB tone. PPI was calculated as the percentage of the average startle at each decibel over the average startle at 0 dB (no tone). After PPI training, mice were tested for startle amplitude over a range of decibels from 70 to 120 dB.

Morris water maze

Mice received a 2-day pretraining before Morris water maze in which they were placed in a small tub (30.5 cm × 61 cm) to find a fixed, hidden platform. They received eight trials per day in which they were given 30 s to find the platform. Mice who did not reach the platform within 10 s for six of eight trials on the second day did not proceed to the Morris water maze. More than 95% of the mice passed the pretraining. For the Morris water maze, mice were placed in a 120-cm-diameter pool that was made opaque with white washable paint. A 10-cm-diameter platform was placed in the center of the northeast (“target”) quadrant of the pool, 1 cm under the surface of the water. Mice were placed in the pool starting in each of the four ordinary (N, S, E, W) directions in a pseudo-random order. A mouse was allowed 60 s to find the platform, and if unsuccessful, they were guided to the platform by the experimenter. After reaching the platform, mice remained there for 5 s before removal from the pool. Four trials happened per day, with a 5-min inter-trial interval. Mice were trained for a total of 10 days. On day 11, the platform was removed for the probe trial, in which the mice swam in the pool for 60 s, and the time spent in each quadrant was recorded. On day 12, the platform was moved to the southeast corner, and its location was made obvious using a flag for the visible probe trial. Mouse movements were recorded and analyzed by the HVS Water software (HVS Image).

Fear conditioning

On day 1, mice were placed in a shock chamber for a 6-min training period, during the last 3 min of which they were exposed to three pairings of a 20-s shock followed by a 2-s 0.6-mA shock. On day 2, mice were placed in the chamber without the tone for 3 min, and the extent of freezing was recorded. Four hours later, mice were placed in a different context for 7 min, and during the last 4 min, they received three exposures to the tone. Mouse freezing was recorded with the FreezeFrame program and analyzed using the FreezeView program (Actimetrics).

Histology and immunohistochemistry

Mice were sacrificed with isoflurane and perfused with 20 ml of ice-cold PBS followed by 20 ml of ice-cold 4% paraformaldehyde (PFA) in PBS. Brains were removed and postfixed in 4% PFA overnight at 4°C. Brains were immobilized in 5% agarose in PBS, and 50-μm-thick sections were sliced on a Leica VT1000 S vibratome. Sections were stored in 0.02% sodium azide in PBS at 4°C. For cresyl violet staining, sections were mounted on charged slides and dried at room temperature overnight. Slides were serially placed in 100% ethanol, 95% ethanol, and double-distilled water, and then stained in 0.1% cresyl violet. Slides were destained in 95% ethanol, then placed in 100% ethanol and xylene, and mounted. NeuN and Reelin immunohistochemistry was done by blocking slices in 3% goat serum for 3 hours at 4°C, then overnight in 1:300 NeuN or 1:500 G10 antibody. Alexa Fluor 594 goat anti-mouse secondary antibody was applied for 2 hours at room temperature, and then hippocampi were imaged at 20× for NeuN. Sequential images of the anti-Reelin sections were acquired using a 10× objective and stitched together using Microsoft Image Composite Editor. For Aβ immunostaining, sections were blocked in 3% H2O2 in methanol for 20 min, followed by 88% formic acid pretreatment for 3 min. The sections were blocked for 2 hours at room temperature with tris-buffered saline (TBS) containing 10% normal horse serum, 2% dl -lysine, 0.25% Triton-X, and a Fab mouse immunoglobulin G (IgG) (H&L) antibody fragment of anti-mouse IgG (1:1000 Rockland Immunochemicals Inc.). Aβ was detected with the antibody 4G8 (1:1000 Covance) followed by incubation with biotinylated anti-mouse IgG secondary antibody. Bound antibodies were visualized by using an ABC (avidin-biotin complex) kit (Vector Laboratories) and a diaminobenzidine kit (Sigma).

Golgi staining

Golgi staining was performed using the FD Rapid GolgiStain Kit (FD Neurotechnologies) according to the manufacturer’s instructions. Slices of 200-μm thickness were obtained with a vibratome (4). Z-sections of the Golgi-stained brains were acquired to measure the spine density of CA1 apical dendrites. Images were zoomed in 4× to measure the height and width of the spines.

Granule cell dispersion

Six serial sections of dorsal hippocampus were taken from each fixed brain and stained with cresyl violet. Images were taken at 20×. The length of the dentate gyrus was divided into 100-μm segments, and at the center of each segment, the width was measured. The average width per animal was taken for each n.

Aβ quantification

Protein extraction from fresh-frozen mouse forebrain (0.4 g) was carried out in 1 ml of 1× TBS containing protease and phosphatase inhibitors. The tissue was homogenized with a micropestle (Eppendorf) followed by sonication. The homogenate was centrifuged for 30 min at 14,000g at 4°C. The supernatant (soluble fraction) was transferred into fresh tubes and kept at −80°C until further use. The remaining pellet was resuspended in 1 ml of PBS containing 1% Triton-X followed by sonication and centrifugation as previously mentioned. For the Aβ ELISA, the tissue was homogenized in PBS and then centrifuged at 14,000 rpm for 25 min at 4°C. The supernatant was reserved (soluble fraction), and the pellet was homogenized in 0.5 M guanidine, allowed to solubilize for 3 hours, and then spun at 14,000 rpm for 25 min (insoluble fraction). A sandwich ELISA was performed using antibodies donated by D. Holtzman. Briefly, Nunc MaxiSorp (Thermo) plates were coated with either HJ2 (anti-Aβ40) or HJ7.4 (anti-Aβ42) and incubated overnight at 4°C. Plates were then incubated with blocking buffer for 1.5 hours. Plates were incubated overnight with the soluble and insoluble tissue samples. The plates were then incubated with HJ5.1-biotin, which recognizes both forms of Aβ. The plates were coated with streptavidin–poly-HRP40 (Pierce) and then developed with Super Slow 3,3′,5,5′-tetramethylbenzidine (Sigma).

Field electrophysiology and θ-burst LTP

θ-Burst LTP was performed as previously described (2). Briefly, mice were deeply anesthetized with isoflurane, and their brains were quickly removed and placed in ice-cold high-sucrose slicing solution (110 mM sucrose, 60 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 28 mM NaHCO3, 0.5 mM CaCl2, 5 mM glucose, 0.6 mM ascorbic acid, 7 mM MgSO4). Transverse slices (350 μm) were cut using a Leica VT1000S vibratome. Slices were allowed to recover in ACSF (124 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 26 mM NaHCO3, 10 mM d -glucose, 2 mM CaCl2, 1 mM MgSO4) for 1 hour at room temperature before the experiments. For recording, slices were transferred to an interface chamber perfused with ACSF at 31°C. Slices were stimulated in the stratum radiatum with concentric bipolar electrodes (FHC) using an isolated pulse stimulator. The stimulus intensity was set to 40 to 60% of the maximum peak amplitude, as determined by measuring the input-output curve. After the baseline stabilized, a θ-burst was applied using a train of four 100-Hz pulses repeated 10 times with 200-ms intervals, and the train was repeated five times at 10-s intervals. The resulting LTP was measured for 1 hour after θ-burst stimulation. Data were analyzed using LabView 7.0.

Statistinė analizė

Data were analyzed with GraphPad Prism software (version 6.0, GraphPad Software). Data are shown as means ± SEM, and statistical significance was set at P < 0,05.


Žiūrėti video įrašą: In vivo vs. in vitro drug development (Spalio Mėn 2022).