Informacija

Kaip retroviruso RNR paverčiama cDNR?

Kaip retroviruso RNR paverčiama cDNR?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Retrovirusas (onkovirusas) turi RNR. Jis taip pat turi molekulę, vadinamą atvirkštine transkriptaze. Ši molekulė transkribuoja RNR į cDNR. Ši cDNR yra viruso RNR genomo DNR kopija

RNR vietoj timino yra Uracilas, o DNR vietoj uracilo yra timinas. Taigi, kaip RNR gali būti paversta DNR? Kur patenka Uracilis ir iš kur atsiranda timinas?


RNR vietoj timino yra Uracilas, o DNR vietoj uracilo yra timinas. Taigi, kaip RNR gali būti paversta DNR?

Manau, galbūt norėsite užduoti elementaresnį klausimą. DNR ir RNR yra labai panašios, skiriasi tik deguonis. Tai turi didelių pasekmių organizmams, o gyvybė, kaip mes žinome, naudoja DNR ir RNR labai skirtingiems tikslams. DNR saugo genomą, pateikiantį gyvenimo instrukcijas, o trumpai tariant, RNR yra tai, kaip ši žinia paverčiama baltymu, kad būtų naudingas veiksmas. RNR paprastai yra mažiau stabili nei DNR, todėl toks išdėstymas veikia gerai.

DNR reguliariai ir nuolat transkribuojama į RNR, todėl timinas reguliariai naudojamas Uracil naudai. Čia yra fantastinis Atsakymas čia, Biology.SE jau sprendžiamas kodėl todėl siūlau tai perskaityti. The kaip yra gana paprasta, naudojamos skirtingos molekulės! DNR polimerazėse yra timinas, o RNR polimerazėse yra Uracilas. Atvirkštinė transkriptazė, kurią koduoja retrovirusas, daro būtent tai: ji transkribuoja RNR į DNR, naudodama timiną, o ne Uracilą. Ląstelėje yra ir uracilo, ir timino, todėl juos galima naudoti.


Manau, kad tai gali būti naudinga norint parodyti skirtumą tarp uracilo ir timino

Jie yra labai panašios struktūros. Dalis, kuri yra susijusi su bazių poravimu, iš tikrųjų yra azotas ir deguonis, esantis toliausiai nuo cukraus. Žiūrėkite žemiau:

Taigi, turint papildomą metilo grupę kitoje molekulės pusėje, bazių poravimasis nenutrūksta. Ir atminkite, kad su DNR/RNR sinteze turite šabloną, o nauja grandinė yra pagrįsta šablonu. Taigi, kai RT fermentas Medhat pamini, kad šabloninėje RNR susiduria su adeninu, jis suporuos jį su timidinu. Ir kai jis susiduria su uracilu, jis gali susieti jį su adeninu. Fermentas yra specialiai sukonstruotas taip, kad į jį būtų įtrauktas tik timinas, o ne uracilas, todėl jis skiriasi.


CDNR sintezė

Kad ir kokie būtų jūsų reikalavimai, yra Bio-Rad cDNR sintezės rinkinys, kuris atitinka jūsų poreikius.

Reliance Select cDNA Synthesis
rinkinys

Pasirinkite Reliance Select cDNA sintezės rinkinį, kad užfiksuotumėte daug GC turinčius taikinius ir antrinę struktūrą FFPE ir sudėtingus mėginius su suardyta RNR arba inhibitoriais.

Atvirkštinės transkripcijos supermiksas
RT-qPCR

Pasirinkite iScript atvirkštinės transkripcijos supermiksą, kad galėtumėte greitai, efektyviai ir jautriai sintezuoti cDNR RT-qPCR ir vieną mėgintuvėlį ir 40 minučių protokolą.

Pažangus cDNR sintezės rinkinys
RT-qPCR

Pasirinkite „iScript Advanced cDNA Synthesis Kit“, kurio dinaminis diapazonas yra išplėstas ir talpa iki 7,5 mikrogramų įvesties RNR.


Kaip retroviruso RNR paverčiama cDNR? – Biologija

Šis fermentas atvirkštinė transkriptazė leidžia mums naudoti RNR šabloną dvigrandės cDNR kopijos gamybai. Atvirkštinę transkriptazę atrado H. Teminas ir D. Baltimore'as, tirdami retrovirusus. Retrovirusuose yra RNR genomas, kuris paverčiamas DNR kopija ir integruojamas į šeimininko genomą replikacijos ciklo metu. Tai įdomus virusų rinkinys, įskaitant daugybę navikų virusų ir AIDS virusą ŽIV.

Atvirkštinė transkriptazė yra nuo RNR priklausoma DNR polimerazė. Jis naudoja RNR kaip šabloną, reikalauja dNTP ir pradmenų (laisvo 3' OH), kad inicijuotų DNR polimerizaciją.

Paprastai naudojami dviejų tipų gruntai.

Oligo-dT inicijuoja pradėjimą nuo mRNR 3' galo.
cDNR, pradurtos oligo-dT, yra praturtintos mRNR 3' galais.

Atsitiktiniai oligonukleotidai gali hibridizuotis bet kur mRNR sekoje ir pradėti cDNR sintezę. Atsitiktinai paruoštos cDNR pasiskirsto per šablono ilgį ir todėl labiau reprezentuoja mRNR populiaciją.

mRNR paprastai yra trumpos (palyginti su genomu) - dauguma mRNR yra trumpesnės nei 6 kb ir tik retos mRNR viršija 10 kb.
Šis mažas dydis reiškia, kad tiek plazmidės, tiek fago įterpimo vektoriai yra tinkami kDNR bibliotekoms kurti.
(priešingai nei genominėse bibliotekose, kur pirmenybė teikiama fagų pakeitimo vektoriams).

Diskutuodami apie genomo bibliotekas, mes sutelkėme dėmesį į visišką genomo aprėptį.
Atsitiktiniai genominiai fragmentai buvo sukurti iš dalies virškinant dažnu pjovimo fermentu.
Gautoje atsitiktinių šautuvų bibliotekoje yra keli persidengiantys klonai, apimantys visą genomo seką.

cDNR bibliotekos yra šiek tiek kitokios.
Čia kiekvienas bakterinis transformantas arba supakuotas fagas yra unikali mRNR molekulė.
Rekombinantai, turintys tą pačią DNR seką, reiškia skirtingas šablono molekules, esančias pirminėje mRNR populiacijoje.

Pavyzdžiui, ląstelėje vienu metu yra 100 000 mRNR molekulių
10% jų yra labai išreikštos mRNR (tarkime, aktino mRNR)
tada pirminėje cDNR bibliotekoje, kurią sudaro 100 000 klonų,
10% iš jų (10 000) bus aktino cDNR.
Arba galite tiesiog patikrinti kelias šimtas cDNR ir vis tiek rasti aktino kDNR.

Na, tai labai puiku, jei norite studijuoti aktiną.

Ką daryti, jei norite ištirti retą transkripcijos faktorių, kuris išreiškiamas tik žemu lygiu.
Jūsų 100 000 mRNR gali būti tik 10 mRNR, koduojančių jūsų transkripcijos faktorių.
Dabar turėtumėte patikrinti visą savo 100 000 klonų biblioteką.

Jei jūsų nuorašas buvo išreikštas tik trumpą laiką žemu lygiu, jis gali būti dar žemesniu lygiu.

Dauguma rekombinantinių fagų standartinėje cDNR bibliotekoje turi labai išreikštas sekas.
Retų mRNR sunku rasti, nebent jūsų biblioteka yra labai didelė (rekombinantų skaičius – turėtų būti daugiau nei 106 nepriklausomi rekombinantai, kad apimtų 100 000 nuorašų mRNR populiaciją su 99% tikimybe).

Alternatyva vis didesnio nepriklausomų rekombinantų skaičiaus patikrinimui yra „normalizuoti“ biblioteką naudojant hibridizacijos kinetiką, kaip aptarėme anksčiau.
Normalizuotose bibliotekose yra mažiau labai išreikštų mRNR kopijų (pašalinamos hibridizacijos metu) ir daugiau retų transkriptų kopijų (santykine prasme).


Retrovirusas

Mūsų redaktoriai peržiūrės tai, ką pateikėte, ir nuspręs, ar pataisyti straipsnį.

Retrovirusas, bet kuri virusų grupė, priklausanti Retroviridae šeimai ir kuriai būdingas genetinis planas ribonukleino rūgšties (RNR) pavidalu. Retrovirusai pavadinti dėl fermento, žinomo kaip atvirkštinė transkriptazė, kurį 1971 m. nepriklausomai atrado amerikiečių virusologai Howardas Teminas ir Davidas Baltimore'as. Atvirkštinė transkriptazė transkribuoja RNR į dezoksiribonukleino rūgštį (DNR), o tai yra procesas, kurio metu pakeičiama įprasta ląstelių transkripcijos kryptis (DNR į RNR). Atvirkštinės transkriptazės veikimas leidžia retroviruso genetinei medžiagai visam laikui patekti į užkrėstos ląstelės DNR genomą. Fermentas yra plačiai naudojamas biologijos moksluose genams sintetinti.

Retrovirusai sukelia auglių augimą ir tam tikras gyvūnų vėžio formas ir yra susiję su lėtomis gyvūnų infekcijomis, tokiomis kaip arklių infekcinė anemija. Žmonėms retrovirusas, žinomas kaip žmogaus T-ląstelių limfotropinis 1 tipo virusas (HTLV-1), sukelia tam tikrą vėžio formą, vadinamą suaugusiųjų T ląstelių leukemija (ATL). Tai taip pat gali sukelti neurodegeneracinę būklę, žinomą kaip su HTLV-1 susijusi mielopatija / tropinė spastinė paraparezė (HAM / TSP). Glaudžiai susijęs virusas, pavadintas HTLV-2, yra susijęs su palyginti lengvais neurologiniais sutrikimais, tačiau nebuvo nustatytas kaip žmonių ligų sukėlėjas. Manoma, kad net 20 milijonų žmonių visame pasaulyje yra užsikrėtę HTLV, tačiau tik nedidelė dalis užsikrėtusių asmenų iš tikrųjų išsivysto ATL arba HAM/TSP. Retrovirusas, žinomas kaip žmogaus imunodeficito virusas (ŽIV), sukelia žmonėms įgytą imunodeficito sindromą (AIDS). ŽIV yra glaudžiai susijęs su pavyzdžio imunodeficito virusu (SIV), retrovirusu, randamu šimpanzėse ir gorilose.

Vadinamieji endogeniniai retrovirusai (ERV) yra nuolatiniai daugelio gyvūnų genomų bruožai. ERV sudaro išnykusių arba „iškastinio“ virusų genetinė medžiaga, kurių genomo sandara panaši į išlikusių retrovirusų. Žmogaus ERV (HERV) evoliucijos eigoje pasiskirstė žmogaus DNR. Jie perduodami iš kartos į kartą ir sudaro maždaug 1–5 procentus žmogaus genomo. Įtariama, kad HERV turėjo įtakos tam tikrų žmogaus genomo elementų evoliucijai. Jie taip pat buvo susiję su tam tikromis žmonių ligomis, įskaitant išsėtinę sklerozę.

HTLV-1 buvo pirmasis atrastas žmogaus retrovirusas, kurį 1979 metais aptiko ir išskyrė amerikiečių virusologas Robertas C. Gallo ir jo kolegos. Pirmą kartą ŽIV buvo išskirtas 1983 m.


Endogeninių virusinių elementų paplitimas ir galimi biologiniai vaidmenys vabzdžių genomuose

Šiuolaikiniai genomo sekos nustatymo ir bioinformatikos metodai aptiko daugybę DNR sekų, gautų iš DNR ir RNR viruso genomų, integruotų tiek į stuburinių, tiek į vabzdžių genomus, pavyzdžių. Retrovirusai koduoja nuo RNR priklausomas DNR polimerazes (atvirkštines transkriptazes) ir integrazes, kurios paverčia savo RNR viruso genomus į DNR provirusus ir palengvina provirusinės DNR integraciją į šeimininko genomą. Keista, kad DNR sekos, gautos iš RNR virusų, kurios nekoduoja šių fermentų, pasitaiko ir šeimininko genomuose. Neretrovirusinės integruotos RNR virusų sekos (NIRVS) arbovirusinių vektorių genomuose atsiranda gana dažnai. Aedes aegypti ir Aedes albopictus, nėra paskirstomi atsitiktinai ir galbūt prisideda prie uodų antivirusinio imuniteto, o tai rodo, kad šie uodai gali būti pavyzdinė sistema, padedanti atskleisti NIRVS funkciją. Čia mes sprendžiame šiuos klausimus: Kas skatina DNR sintezę iš neretrovirusinių RNR virusų genomų? Kaip vyksta viruso kDNR integracija į šeimininko DNR ir kokia yra jos biologinė funkcija (jei yra)? Apžvelgiame dabartines žinias apie virusų integraciją vabzdžių genomuose, iškeliame hipotezes apie NIRVS formavimosi mechanizmus ir galimą jų poveikį vabzdžių biologijai, ypač antivirusiniam imunitetui, ir siūlome tolesnių tyrimų kryptis.


Retrovirusams „beveik pusė milijardo metų“

Retrovirusas turi membraną, kurioje yra glikoproteinų, kurie gali prisijungti prie ląstelės-šeimininkės baltymo receptoriaus. Ląstelėje yra dvi RNR grandinės, turinčios tris fermentus: proteazę, atvirkštinę transkriptazę ir integrazę (1). Pirmasis replikacijos žingsnis yra glikoproteino prisijungimas prie receptoriaus baltymo (2). Kai jie susijungia, ląstelės membrana suyra ir tampa ląstelės šeimininkės dalimi, o RNR grandinės ir fermentai patenka į ląstelę (3). Ląstelėje atvirkštinė transkriptazė sukuria papildomą DNR grandinę iš retroviruso RNR ir RNR suskaidoma. Ši DNR grandinė vadinama cDNR (4). Tada cDNR replikuojama, o dvi grandinės sudaro silpną ryšį ir patenka į branduolį (5). Patekusi į branduolį, DNR integrazės pagalba integruojama į šeimininko ląstelės DNR (6). Ši ląstelė gali likti ramybės būsenoje arba RNR gali būti susintetinta iš DNR ir naudojama naujo retroviruso baltymams sukurti (7). Ribosomų vienetai naudojami viruso mRNR transkribavimui į aminorūgščių sekas, kurios gali virsti baltymais šiurkščiame endoplazminiame tinkle. Šis žingsnis taip pat gamins virusinius fermentus ir kapsidų baltymus (8). Virusinė RNR bus pagaminta branduolyje. Tada šie gabalėliai surenkami ir nuimami nuo ląstelės membranos kaip naujas retrovirusas (9). Kreditas: Wikipedia/CC BY-SA 3.0

Remiantis naujais Oksfordo universiteto mokslininkų tyrimais, retrovirusai – virusų šeima, kuriai priklauso ir ŽIV – yra beveik pusės milijardo metų senumo. Tai keliais šimtais milijonų metų senesnė, nei manyta anksčiau, ir leidžia manyti, kad retrovirusai kilę iš senovės jūrinės kilmės, nes buvo su savo gyvūnų šeimininkais per evoliucinį perėjimą iš jūros į sausumą.

Išvados, paskelbtos žurnale Gamtos komunikacijos, padės mums geriau suprasti besitęsiančias „ginklavimosi varžybas“ tarp virusų ir jų šeimininkų.

Tyrimo autorius dr. Aris Katzourakis iš Oksfordo universiteto Zoologijos katedros sakė: "Labai mažai žinoma apie senovinę retrovirusų kilmę, iš dalies dėl to, kad nėra geologinių iškastinių įrašų. Retrovirusai plačiai paplitę tarp stuburinių gyvūnų ir gali plisti tarp šeimininkų. , sukeliančias naujas ligas, tokias kaip ŽIV, ir įrodyta, kad jos gali šokinėti tarp toli giminingų šeimininkų, tokių kaip paukščiai ir žinduoliai. Tačiau iki šiol buvo manoma, kad retrovirusai yra santykinai naujokai – galbūt net prieš 100 mln. amžiaus.

"Mūsų nauji tyrimai rodo, kad retrovirusai yra mažiausiai 450 milijonų metų senesni, jei ne senesni, ir kad jie turėjo atsirasti kartu su jų stuburiniais šeimininkais ankstyvojoje paleozojaus epochoje. Be to, jie būtų buvę mūsų šalyje. stuburinių protėvių prieš žemės kolonizavimą ir lydėjo savo šeimininkus per visą perėjimą iš jūros į sausumą, iki pat šių dienų.

Retrovirusai yra virusų šeima, kuriai priklauso ŽIV virusas, atsakingas už AIDS pandemiją. Jie taip pat gali sukelti vėžį ir imunodeficitą įvairiems gyvūnams. „Retro“ jų pavadinimo dalis kilusi iš to, kad jie yra pagaminti iš RNR, kurią jie gali paversti DNR ir įterpti į šeimininko genomą – priešinga kryptimi nei įprastas informacijos srautas ląstelėje. Ši savybė reiškia, kad retkarčiais jie gali būti paveldimi kaip endogeniniai retrovirusai (vidinės kilmės retrovirusai), sudarydami virtualų genomo iškastinį įrašą, kurį galima panaudoti norint atsigręžti į jų evoliucijos istoriją.

Šiame tyrime buvo naudojamos endogeninių retrovirusų genomo sekos, panašios į „putotuosius“ virusus – virusų grupę, kuri linkusi skirtis kartu su savo šeimininkais. Putoti virusai yra plačiai paplitę tarp žinduolių, o šiame tyrime mokslininkai atkasė genomines fosilijas putplasčio tipo retrovirusams labai įvairiuose šeimininkuose, įskaitant spinduliuotąsias žuvis ir varliagyvius, kuriuose jie anksčiau nebuvo aptikti.

Šio tyrimo metu mokslininkai įveikė vieną iš pagrindinių apribojimų tirdami gilią virusų evoliucijos istoriją: jų greitą evoliuciją. Ši savybė palengvina naujausios virusų istorijos atkūrimą, tačiau užgožia jų tolimesnę praeitį. Tačiau naujas šiame tyrime naudojamas modelis – kartu su putojančių virusų genominiais iškastiniais įrašais – leido mokslininkams paaiškinti akivaizdų evoliucijos greičio sulėtėjimą kuo toliau.

Dr Katzourakis pridūrė: „Šie atradimai rodo, kad šios mediciniškai svarbios virusų grupės amžius yra mažiausiai iki pusės milijardo metų – daug senesnis, nei manyta anksčiau. Jie datuojami stuburinių gyvūnų ištakomis, ir tai suteikia mums kontekstą, kuriame turėtume atsižvelgti į jų dabartinę veiklą ir sąveiką su šeimininkais. Pavyzdžiui, turime atsižvelgti į stuburinių gyvūnų prisitaikymus kovoti su virusais ir atitinkamas kovos su virusais priemones, kaip nuolatinių ginklavimosi varžybų, kurios tęsiasi šimtus milijonus metų.

"Mūsų numanoma retrovirusų atsiradimo data sutampa su adaptyvaus imuniteto ištakomis, todėl tikėtina, kad retrovirusai suvaidino svarbų vaidmenį šios pagrindinės stuburinių antivirusinės gynybos priemonės atsiradimui. Kaip mes suprantame sąveikos pobūdį virusų ir šeimininko imuniteto, mes būsime geriau pasirengę įsikišti į šias subtiliai subalansuotas ginklavimosi varžybas, kad sukurtume naujus gydymo būdus ir intervencijas.

„Ir kurdami aiškesnį vaizdą apie įvairių virusų grupių, kurios šiandien užkrečia mus, kilmę, turėtume priartėti prie jų galutinės kilmės paslapties išaiškinimo.


RT-qPCR naudojami komponentai:

Atvirkštinės transkripcijos PGR komponentų pasirinkimas yra toks pat svarbus kaip ir temperatūros sąlygų parinkimas, tačiau dėl to nesijaudinkite, paruoštame naudoti atvirkštinės transkripcijos PGR rinkinyje yra visos sudedamosios dalys, esančios reakcijos buferyje ir reakcijos mišinyje.

Kiekvienos PGR sudedamosios dalies ir jo kiekio pasirinkimas yra toks pat svarbus kaip ir temperatūros sąlygų pasirinkimas PGR. Šiais laikais paruošti naudoti atvirkštinės transkripcijos PGR rinkiniai daro jūsų darbą efektyvesnį, nes juose yra visos sudedamosios dalys. Pažiūrėkime kai kuriuos RT-PGR komponentus,

  • Atvirkštinės transkriptazės fermentas su RNazės aktyvumu
  • RNazė H (jei atvirkštinė transkriptazė jos neturi)
  • DNR polimerazė

Abstraktus

Daugelis virusų perneša daugiau nei vieną nukleino rūgšties segmentą į viriono dalelę, tačiau retrovirusai yra vienintelė žinoma virusų grupė, kurioje yra dvi identiškos (arba beveik identiškos) RNR genomo kopijos virione. Šie RNR genomai yra nekovalentiškai sujungti per procesą, žinomą kaip genomo RNR dimerizacija. Vienareikšmiškai retrovirusinio genomo RNR dimerizacija yra labai svarbi veiksmingai retrovirusinei replikacijai. Šiame straipsnyje apžvelgiamas mūsų dabartinis supratimas apie ryšį tarp retrovirusinio genomo konformacijos, dimerizacijos ir replikacijos.


7 veiksmas: duomenų analizė

A. Duomenų normalizavimas—Lyginamasis Cq metodas

qPCR duomenų normalizavimo svarba buvo ne kartą pabrėžta [1, 26]. Duomenų normalizavimas yra svarbus qPCR darbo eigos žingsnis, nes jis koreguoja kelių etapų, įskaitant RNR gryninimą, RNR koncentracijos įvertinimą, taip pat atvirkštinės transkripcijos ir amplifikacijos efektyvumą, skirtumus. Normalizavimas su stabiliai išreikštais etaloniniais genais kaip vidine kontrole, žinoma kaip lyginamoji Cq arba Δ㥌q metodas yra labiausiai paplitęs mRNR duomenų normalizavimo metodas. Tačiau norint įsitikinti, kad ši technika atliekama teisingai, reikia tinkamai patvirtinti [27]. Dėl palyginimo Cq Kad metodas būtų tinkamas, svarbu įsitikinti, kad etaloniniai genai ir tiksliniai genai turi panašų amplifikacijos efektyvumą, kaip galiojantis lyginamasis C.q metodas pagrįstas papildoma panašaus stiprinimo efektyvumo prielaida [28]. 㥌 galima nubraižyti standartinę kreivęq (skirtumas tarp etaloninio ir tikslinio geno, palyginti su cDNR įvesties logaritmi), o absoliuti nuolydžio vertė turėtų būti π,1 [29]. Žr. 㥌 pavyzdįq tarp Ciklofilinas ir PGC-1α 6 pav. Jei nepavyksta gauti etaloninių genų, kurių amplifikacijos efektyvumas panašus į taikinį, skaičiavimui siūloma naudoti Pfaffl metodą, kuriame skaičiavimas koreguojamas pagal tikslinių ir etaloninių genų amplifikacijos efektyvumo skirtumus [30, 31].

Lyginamasis Cq metodas normalizuoja Cq tikslinio geno vertę su vidiniais etaloniniais genais prieš palyginant mėginius. Pirma, skirtumas tarp Cq reikšmės (㥌q) tikslinio geno ir kelių etaloninių genų geometrinis vidurkis apskaičiuojamas kiekvienam mėginiui, o tada skirtumas tarp 㥌q (Δ㥌q) apskaičiuojamas tarp dviejų mėginių (pvz., kontrolinio ir gydymo arba prieš ir po apdorojimo). Dviejų pavyzdžių išraiškos kartotinis pokytis apskaičiuojamas kaip 2 -Δ㥌q, kur 2 gaunamas iš 1 + efektyvumas, o efektyvumas laikomas 1 (ty 100 % efektyvumas) [28]. Mūsų rekomendacija naudoti lyginamąjį Cq metodas nurodytas 9 langelyje.

9 langelis

Svarbu užtikrinti, kad etaloniniai genai ir tiksliniai genai turėtų panašų amplifikacijos efektyvumą naudojant lyginamąjį C.q kitu atveju reikėtų apsvarstyti Pfaffl metodą.

B. Referencinių genų pasirinkimas

Kai kurie tradiciniai etaloniniai genai buvo plačiai naudojami qPCR analizėje. Apžvalgos straipsnyje teigiama, kad buvo panaudota 33 % ir 32 % išraiškos analizės iš 6 didelio poveikio žurnalų. gliceraldehido-3-fosfato dehidrogenazė (GAPDH) ir aktinas beta (ACTB) kaip etaloniniai genai atitinkamai 1999 m. publikuotiems straipsniams [32]. Tačiau toje pačioje apžvalgoje buvo nurodyta, kad abiejų išraiška GAPDH ir ACTB labai skiriasi esant įvairioms eksperimentinėms sąlygoms įvairiuose audiniuose [32]. GAPDH iš pradžių buvo identifikuotas kaip tarpinis glikolizės kelio produktas ir tikimasi, kad jis bus stabiliai visose ląstelėse, todėl buvo pasirinktas kaip etaloninis genas. Tačiau kita veikla GAPDH, įskaitant endocitozės, transliacijos kontrolės ir DNR replikacijos funkcijas [33], buvo pripažintos tik vėliau [32].

Įvairiuose pratimų tyrimuose buvo naudojami įvairūs etaloniniai genai. Mahoney ir kt. - [34] pranešė apie tai β-2-mikroglobulinas (B2M) ir ACTB buvo stabiliausi etaloniniai genai po 300 ekscentrinių susitraukimų, tuo tarpu B2M ir GAPDH buvo stabiliausi po 75 minučių didelio intensyvumo pertraukiamo važiavimo dviračiu. Kito tyrimo metu raumenų biopsijos buvo paimtos prieš, iš karto po ir praėjus 4 valandoms po 30 min. bėgimo takelio bėgimo 70 % VO.2 maks, o RNR buvo išgauta iš 40 atskirų skaidulų. GAPDH buvo nustatyta, kad visuose mėginiuose buvo išreikštas stabiliai [35]. Taigi, naudojant etaloninius genus kaip vidinę kontrolę atliekant pratimų tyrimą, reikia atidžiai įvertinti kiekvieno etaloninio geno stabilumą ir nėra „vieno dydžio visiems tinkančio“ geno, kurį būtų galima naudoti visuose tyrimuose ir su visais pratimų protokolais.

Siekiant sumažinti vidinės kontrolės kintamumą, normalizavimui rekomenduojama naudoti kelis genus [36, 37]. Naudodami mėginius, gautus iš neuroblastomos ląstelių linijų, Vandesompele ir jo kolegos parodė, kad normalizavimas naudojant vieną etaloninį geną lėmė 3,0 karto skirtumus 25% ir 6,4 karto 10% analizuotų atvejų [36]. Etaloninius genus galima įvertinti atliekant statistinę C analizęq vertę arba naudojant turimą programinę įrangą. Yra keletas programinės įrangos programų, skirtų etaloniniam genų įvertinimui naudojant skirtingus analitinius metodus, pvz., BestKeeper [38], NormFinder [39] ir GeNorm [36].

Savo laboratorijoje turime šešis dažniausiai naudojamus etaloninius genus, ACTB, TATA dėžutę surišantis baltymas (TBP), Ciklofilinas, GAPDH, B2M, ir 18S rRNR (4 lentelė). Yra keletas priežasčių, kodėl buvo pasirinkti šie kandidatų etaloniniai genai. Visų pirma, šie šeši genai yra potencialiai stabiliai išreikšti etaloniniai genai ir yra plačiai naudojami atliekant žmogaus mankštos tyrimuose gautų skeleto raumenų mėginių qPCR analizę [34, 35, 40]. Antra, jie priklauso skirtingoms funkcinėms klasėms, todėl mažai tikėtina, kad jie yra bendrai reguliuojami. Tačiau naudojant lyginamąjį Cq Taikant metodą, sunku nustatyti nedidelius genų ekspresijos skirtumus (ty mažiau nei 2 kartus), nebent normalizavimui būtų naudojami keli stabiliai išreikšti etaloniniai genai [36, 41].

4 lentelė

GenePrisijungimo Nr.Funkcija (NCBI nuorodų sekos duomenų bazė [42])
ACTB (aktinas beta) <"tipas":"entrez-nukleotidas","attrs":<"text":"NM_001101.3","term_id":"168480144","term_text":"NM_001101.3">> NM_001101.3Šis genas koduoja vieną iš šešių skirtingų aktino baltymų, kurie yra pagrindinė susitraukimo aparato sudedamoji dalis, ir vieną iš dviejų neraumeninių citoskeleto aktinų.
TBP (TATA dėžutę surišantis baltymas) <"type":"entrez-nukleotidas","attrs":<"text":"NM_003194.4","term_id":"285026518","term_text":"NM_003194.4">> NM_003194.4Šis genas koduoja bendrą transkripcijos faktorių, kuris specifiškai jungiasi prie DNR sekos, vadinamos TATA dėžute, ir padeda nustatyti RNR polimerazę II geno transkripcijos pradžios vietoje.
Ciklofilinas (PPIA, peptidilprolilo cis-trans izomerazė A) <"type":"entrez-nukleotidas","attrs":<"text":"NM_021130.4","term_id":"665821272","term_text":"NM_021130.4">> NM_021130.4Šis genas koduoja baltymą, kuris katalizuoja prolino imidinių peptidinių jungčių oligopeptiduose cis-trans izomerizaciją ir pagreitina baltymų susilankstymą.
GAPDH (gliceraldehido-3-fosfato dehidrogenazė) <"tipas":"entrez-nukleotidas","attrs":<"text":"NM_001289746.1","term_id":"576583523","term_text":"NM_001289746.1">> NM_0012897461.Šis genas koduoja pagrindinį fermentą glikolitiniame kelyje, kuris katalizuoja grįžtamąjį oksidacinį gliceraldehido-3-fosfato fosforilinimą, esant neorganiniam fosfatui ir nikotinamido adenino dinukleotidui (NAD).
B2M (β-2-mikroglobulinas) <"tipas":"entrez-nukleotidas","attrs":<"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2">> NM_004048.2Šis genas koduoja serumo baltymą, susijusį su pagrindine histokompatibilumo komplekso (MHC) I klasės sunkiąja grandine, esančia beveik visų branduolių ląstelių paviršiuje.
18S rRNR (RNR, 18S ribosomų) <"tipas":"entrez-nukleotidas","attrs":<"text":"NR_003286.2","term_id":"225637497","term_text":"NR_003286.2">> NR_003286.2Šis genas reiškia vieno rDNR pakartojimo dalį, koduojančią 18S rRNR.

4 eksperimentas

Atliekant mūsų pratimų su žmonėmis tyrimą (žr. Medžiagos ir metodai), raumenų mėginiai buvo paimti iš 9 ramybės būsenos dalyvių (pradinis lygis), o po to iškart po (0 val.) ir 3 val. (3 val.) po paskutinės 4 savaičių trukmės treniruotės. mokymo intervencija. Visi raumenų mėginiai buvo greitai užšaldyti iškart po raumenų biopsijos, o visų mėginių RNR (n = 27) buvo išskirta naudojant RNeasy Plus Universal Mini Kit su modifikuotu protokolu (naudojant 2-propanolį) visiems mėginiams, kuriuos gavome. A260/A280 santykis didesnis nei 1,9 ir RQI balas didesnis nei 7 (naudojant Experion automatizuotą elektroforezės sistemą). Tada, prieš atlikdami qPCR analizę, atlikome atvirkštinę transkripciją, kad RNR paverstume cDNR vienu paleidimu. Norėdami rasti stabiliai išreikštus etaloninius genus visuose mėginiuose visais laiko momentais, išbandėme šešis etaloninius genus (ACTB, TBP, Ciklofilinas, GAPDH, B2M, ir 18S rRNR 5 lentelė ir 7 pav.). Tada mes panaudojome RefFinder, kad įvertintume šių genų stabilumą. RefFinder yra internetinis įrankis, galintis vienu metu paleisti keturis nusistovėjusius algoritmus (GeNorm [36], BestKeeper [38], NormFinder [39] ir lyginamąjį delta-CT [43]), kiekvienam priskirti atitinkamą svorį. individualų geną ir apskaičiuokite jų svorio geometrinį vidurkį bendram galutiniam reitingui [44]. Remiantis rekomenduojamu išsamiu RefFlinder reitingu, mūsų kandidatų genai buvo suskirstyti nuo stabiliausių iki mažiausiai stabilių. B2M, TBP, 18S rRNR, ACTB, GAPDH ir Ciklofilinas (5 lentelė).

Cq atskirų reakcijų reikšmės naudojant ACTB, TBP, Ciklofilinas, GAPDH, B2M, ir 18S rRNR pristatomi pradmenys. Visi pavyzdžiai yra iš pratimų tyrimo (n = 9 dalyviai × 3 laiko taškai = 27 pavyzdžiai).

5 lentelė

Reitingavimo tvarka (nuo didžiausios iki mažiausiai stabilios)
Metodas123456
Delta CTTBPB2M18S rRNRACTBGAPDHCiklofilinas
BestKeeperB2MTBP18S rRNRACTBGAPDHCiklofilinas
NormFinderTBPB2M18S rRNRACTBGAPDHCiklofilinas
GenormB2M / 18S rRNRTBPACTBGAPDHCiklofilinas
Rekomenduojamas išsamus reitingasB2MTBP18S rRNRACTBGAPDHCiklofilinas

Norėdami parodyti, kaip galima pasirinkti etaloninius genus, mes pasirenkame PPRG koaktyvatorius 1 alfa (PGC-1α) kaip genų ekspresijos analizės pavyzdį. PGC-1α yra transkripcijos koaktyvatorius, praturtintas skeleto raumenimis. Įrodyta, kad mankšta gali padidėti PGC-1α mRNR kiekis žmonėms [45]. Visų šešių kandidatų etaloninių genų amplifikacijos efektyvumas buvo panašus į mūsų tikslinį geną, PGC-1α (6 lentelė). Mes panaudojome trijų geriausių „RefFinder“ reitinguotų genų geometrinį vidurkį (TBP, B2M, ir 18S rRNR) vėlesniam duomenų normalizavimui. Mūsų rekomendacijos, kaip pasirinkti etaloninius genus, pateiktos 10 langelyje.

6 lentelė

GenePrisijungimo Nr.Pradmenys (į priekį ir atgal)Amplikono dydis (bp)Pradinė padėtis (bp)Efektyvumas (%)Šaltinis
TBP (TATA dėžutę surišantis baltymas) <"type":"entrez-nukleotidas","attrs":<"text":"NM_003194.4","term_id":"285026518","term_text":"NM_003194.4">> NM_003194.4 F: CAGTGACCCAGCAGCATCACT
R: AGGCCAAGCCCTGAGCGTAA
20512199[46]
Ciklofilinas (PPIA, peptidilprolilo cis-trans izomerazė A) <"type":"entrez-nukleotidas","attrs":<"text":"NM_021130.4","term_id":"665821272","term_text":"NM_021130.4">> NM_021130.4 F: GTCAACCCCACCGTGTTCTTC
R: TTTCTGCTGTCTTTGGGACCTTG
10093100[47]
B2M (β-2-mikroglobulinas) <"type":"entrez-nukleotidas","attrs":<"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2">> NM_004048.2 F: TGCTGTCTCCATGTTTGATGTATCT
R: TCTCTGCTCCCCACCTCTAAGT
8658998[36]
ACTB (aktinas beta) <"tipas":"entrez-nukleotidas","attrs":<"text":"NM_001101.3","term_id":"168480144","term_text":"NM_001101.3">> NM_001101.3 F: GAGCACAGAGCCTCGCCTTT
R: TCATCATCCATGGTGAGCTGGC
7026107Sukurta autorių
18S rRNR (RNR, 18S ribosomos 5) <"tipas":"entrez-nukleotidas","attrs":<"text":"NR_003286.2","term_id":"225637497","term_text":"NR_003286.2">> NR_003286.2 F: CTTAGAGGGACAAGTGGCG
R: GGACATCTAAGGGCATCACA
71144399[48]
GAPDH (gliceraldehido-3-fosfato dehidrogenazė) <"tipas":"entrez-nukleotidas","attrs":<"text":"NM_001289746.1","term_id":"576583523","term_text":"NM_001289746.1">> NM_0012897461. F: AATCCCCATCACCATCTTCCA
R: TGGACTCCACGACGTACTCA
82388106[49]
PGC-1α (PPARG koaktyvatorius 1 alfa) <"type":"entrez-nukleotidas","attrs":<"text":"NM_013261.3","term_id":"116284374","term_text":"NM_013261.3">> NM_013261.3 F: CAGCCCTTTTTGCCCAGATCTT
R: TCACTGCACCACTTGAGTCCAC
101199104[50]

10 langelis

Rekomenduojama išbandyti kelis etaloninius genus [36, 37], o kiekvieno geno stabilumas turi būti įvertintas prieš pasirenkant tinkamus etaloninius genus konkrečiam tyrimui. Rekomenduojame naudoti RefFinder etaloninių genų stabilumui įvertinti, nes jis vienu metu vykdo keturis nusistovėjusius algoritmus. Išskyrus etaloninio geno stabilumą, etaloninių genų amplifikacijos efektyvumas turėtų būti panašus į tikslinių genų.

C. Genų ekspresijos normalizavimas naudojant cDNR kiekybinį nustatymą

Rasti stabilius etaloninius genus yra iššūkis atliekant qPCR, o mokslininkai ieško alternatyvių metodų, tokių kaip cDNR kiekybinis nustatymas. Quant-iT ™ OliGreen ssDNR reagentas yra fluorescencinis nukleorūgščių dažiklis, skirtas cDNR kiekybiniam kiekiui nustatyti, ir jis buvo naudojamas daugelyje publikuotų straipsnių, įskaitant tyrimus, kuriuose tiriama genų ekspresija žmogaus skeleto raumenyse reaguojant į pratimą [51�]. Galima problema naudojant OliGreen dažus cDNR kiekiui nustatyti yra ta, kad dažai taip pat yra jautrūs RNR, kaip nurodyta vartotojo vadove “OliGreen reagentas fluorescencija sustiprina, kai yra prijungtas prie RNR” [54].

5 eksperimentas

Norėdami patikrinti OliGreen dažų naudojimo cDNR kiekiui nustatyti specifiškumą ir pagrįstumą, susintetinome cDNR iš keturių skirtingų kiekių (0, 0,25, 0,5 ir 1 μg) RNR, gautos iš 1 eksperimento (‘Good Practice&#xn201d, = 4 kiekvienam RNR įėjimui). Mes taip pat įdėjome 1 μg RNR į–RT kontrolinę reakciją, kurioje nebuvo cDNR (n = 4). cDNR sintezei naudojome iScript ™ Reverse Transcription Supermix (Bio-Rad). Šiame rinkinyje esantis fermentas atvirkštinė transkriptazė turi RNazės H+ aktyvumą, kuris po cDNR sintezės skaido RNR grandinę RNR-DNR hibriduose. Tada cDNR kiekis kiekviename mėginyje buvo išmatuotas naudojant OliGreen dažus (8A pav.). Remiantis ankstesniais tyrimais [51], cDNR mėginiai, susintetinti iš skirtingų RNR kiekių, parodė stiprią teigiamą išmatuotos cDNR koncentracijos ir RNR įvesties koreliaciją (r = 0,9947, P< 0,0001) (8B pav.). Tačiau -RT kontrolinė reakcija, kurioje buvo tik 1 μg RNR, bet nebuvo cDNR, parodė didesnį rodmenį nei cDNR, susintetinta iš 0,5 μg RNR. Šis rezultatas patvirtino, kad OliGreen dažai konkrečiai nematuoja ssDNR, bet matuoja ir RNR. Tai gali sukelti klaidingai didelį cDNR kiekį tyrime, jei RNR nėra tinkamai suardoma. Mūsų rekomendacijos, kaip normalizuoti genų ekspresiją naudojant cDNR kiekybinį nustatymą, pateiktos 11 langelyje.

A: Determination of cDNA amount in reactions with different RNA input. Different amounts of RNA were used to synthesise cDNA (n = 4 for each RNA input), and the relative amount of cDNA in each reaction was measured using OliGreen dye. Values are presented as mean ± SD. B: Correlation between RNA input and average relative amount of cDNA measured.

Box 11

In order to obtain an accurate and specific measurement of cDNA from the Oligreen dye, RNA in the RNA-DNA hybrids needs to be degraded before measurement. This can be achieved by using a reverse transcriptase enzyme with RNase H + activity ( Fig 8 ), or including an RNase degradation step after cDNA synthesis [51].

D. Effect of normalisation methods on the results

Experiment 6

To investigate how normalisation might alter the outcome, we measured the exercise-induced expression of PGC-1α mRNA in the samples from a human exercise study (as described in Experiment 4) and analysed the same set of data in three ways. We performed normalisation using three of the most stable reference genes (TBP, B2M, ir 18S rRNR), based on the reference gene evaluation ( Table 5 ). In comparison, we also used a single reference gene, Cyclophilin, which was the lowest ranked reference gene. Lastly, we analysed the data using the cDNA content measured by Quant-iT ™ OliGreen ssDNA Reagent. We saw a significant difference in gene expression at 3 hours after exercise using all three normalisation options (P < 0.01, Fig 9 ). These exercise-induced fold changes in PGC-1α expression are consistent with the existing literature [40, 45].

Muscle samples were taken at rest (Baseline, Week 0) and immediately post-exercise (0 h), and 3 h post-exercise. Data were analysed using 3 different normalisation methods. Values are fold change ± SD.

There were no significant differences between the fold changes in PGC-1α mRNA content when using different methods of normalisation however, the fold changes were more similar when using three reference genes and cDNA content for normalisation, rather than using one reference gene. The increase of PGC-1α was 3.4 ± 2.0 fold when three reference genes were used for normalisation. When a single reference gene (Cyclophilin) was used for normalisation, the increase in gene expression was 5.1 ± 2.4 fold (P = 0.08 compared to 3 reference genes). When cDNA content was used for normalisation, the increase of gene expression was 3.2 ± 1.9 fold (P = 0.51 compared to 3 reference genes, P = 0.09 compared to 1 reference gene). In certain experimental settings, especially when examining small changes in mRNA level, these different results could lead to different conclusions. This may also help to explain the inter-study variability for exercise-induced changes in mRNA content. As previously suggested, use of a single reference gene is considered ‘not acceptable’ unless its stability has been clearly demonstrated in the same study [1]. Our recommendations for normalising gene expression via reference genes are listed in Box 12.

Box 12

We recommend testing four or more candidate reference genes for each study, and selecting the ones that are stably expressed for data normalisation. In our research laboratory, we chose to use two to three most stable reference genes based on evaluation software for an individual study [45, 55].


DNA provirus hypothesis

In the mid-20th century there were many advances in molecular biology, including the description of DNA in 1953 by American geneticist and biophysicist James D. Watson and British biophysicists Francis Crick and Maurice Wilkins. By the 1960s it was understood that sarcomas are caused by a mutation that results in uncontrolled cell division. It was also evident that RSV was inherited during the division of cancerous cells. This inheritance occurred in a manner agreeing with the Mendelian laws of genetic inheritance—laws that heretofore had been understood to apply only to DNA molecules (pamatyti the articles genetics and heredity).

Scientists hypothesized that, in order for such viral inheritance to occur, a virus would need to transcribe its RNA genome into DNA and then insert this DNA into the host cell genome. Once incorporated into the host genome, the virus would be transcribed as though it were another gene and could produce more RNA virus from its DNA. This hypothesis, called the “DNA provirus hypothesis,” was developed in the late 1950s by American virologist Howard Martin Temin, when he was a postdoctoral fellow in the laboratory of Italian virologist Renato Dulbecco at the California Institute of Technology. Temin’s hypothesis was formally proposed in 1964. The provirus hypothesis came about when experiments demonstrated that an antibiotic called actinomycin D, which is capable of inhibiting DNA and RNA synthesis, inhibited the reproduction of RSV. However, the concept of an RNA molecule’s turning itself into DNA drew very few supporters.