Informacija

Rožinė E.coli ląstelių granulė. Priežastys?

Rožinė E.coli ląstelių granulė. Priežastys?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Surinkau IPTG sukeltą E.coli BL21DE3 ląstelių suspensijos kultūrą sukdamas 5000 aps./min./15 min/4 laipsnių C. Po sukimo granulės atrodė šviesiai rausvos spalvos. Kokios gali būti priežastys?


2.3B: gramneigiama ląstelės sienelė

  • Prisidėjo Gary Kaiser
  • Baltimorės šalies bendruomenės koledžo (Kantonsvilis) profesorius (mikrobiologija)
  1. Nurodykite, kokia spalva nusidažo gramneigiamos bakterijos po dažymo Gram procedūros.
  2. Apibūdinkite gramneigiamos ląstelės sienelės sudėtį ir nurodykite galimas naudingas funkcijas peptidoglikano bakterijai, išorinei membranai, lipopolisacharidams, porinams ir paviršiaus baltymams.
  3. Trumpai aprašykite, kaip LPS ir kiti gramneigiamos ląstelės sienelės PAMP gali skatinti uždegimą.
  4. Nurodykite bakterijų adhezinų, sekrecijos sistemų ir invazinų funkciją.
  5. Apibrėžkite periplazmą.
  6. Apibrėžkite antigeną ir epitopą.

Paryškinta bakterija

  1. Perskaitykite aprašymą Escherichia coli, ir suderinkite bakteriją su organizmo ir jos sukeliamos infekcijos aprašymu.

Išskirtinė liga: šlapimo takų infekcijos (UTI)

Dabar pažvelgsime į gramneigiamų bakterijų ląstelės sienelę. Kaip minėta ankstesniame skyriuje apie peptidoglikaną, gramneigiamos bakterijos yra tos, kurios išblunka dažymo Gram procedūros metu, pasiima priešdėmės safraniną ir atrodo rausvos spalvos ((PageIndex<2>)B.1 pav.).

(PageIndex<2>)B.1 paveikslas: Gramo dažymas Escherichia coli. Pastaba Gramneigiamos (rožinės) bacilos.

Įprastos medicininės svarbos gramneigiamos bakterijos apima Salmonella rūšis, Shigella rūšis, Neisseria gonorrhoeae, Neisseria meningitidis, Haemophilus influenzae, Escherichia coli, Klebsiella pneumoniae, Proteus rūšys ir Pseudomonas aeruginosa.

Klinikinė liga

  • E. coli sukelia apie 80 procentų visų nesudėtingų šlapimo takų infekcijos (UTI) ir daugiau nei 50 procentų hospitalinių UTI. UTI sukelia daugiau nei 7 000 000 apsilankymų pas gydytoją per metus JAV. Nuo 35 iki 40 procentų visų hospitalinių infekcijų, apie 900 000 per metus JAV, yra UTI ir dažniausiai yra susijusios su šlapimo kateterizavimu.
  • E. coli priežasčių žaizdų infekcijos, dažniausiai dėl išorinių žaizdų užteršimo išmatomis arba dėl žaizdų, kurios sukelia žarnyno traumą, pvz., chirurginės žaizdos, šautinės žaizdos, žaizdos peiliu ir kt.
  • E. coli yra labiausiai paplitusi gramneigiama bakterija, sukelianti sepsį. Septicemija yra bakterijų patekimo į kraują pasekmė. Paprastai jie patenka į kraują iš kitos infekcijos vietos, pavyzdžiui, užkrėsto inksto, žaizdos ar plaučių. JAV kasmet įvyksta maždaug 500 000 septicemijos atvejų, o mirtingumas yra nuo 20 iki 50 procentų. Maždaug 45 procentai septicemijos atvejų atsiranda dėl gramneigiamų bakterijų. Klebsiella, Proteus, Enterobacter, Serratia, ir E. coli, yra visos įprastos gramneigiamos bakterijos, sukeliančios septicemiją.
  • E. coli, kartu su B grupės streptokokais, yra pagrindinė priežastis naujagimių meningitas.
  • Nors E. coli yra viena iš dominuojančių normalios floros žmonių ir gyvūnų žarnyne, kai kurios padermės gali sukelti gastroenteritas, žarnyno infekcija.
    • Enterotoksigeninis E. coli (ETEC) gamina enterotoksinus, dėl kurių plonosiose žarnose netenkama natrio jonų ir vandens, dėl ko atsiranda vandeningas viduriavimas. Daugiau nei pusė visų keliautojų viduriavimo sukelia ETEC beveik 80 000 atvejų per metus JAV.
    • Enteropatogeninis E. coli (EPEC) sukelia endeminį viduriavimą besivystančio pasaulio vietose, ypač jaunesniems nei 6 mėnesių kūdikiams. Bakterija pažeidžia normalius plonųjų žarnų epitelio ląstelių mikrovillius, dėl kurių atsiranda bloga absorbcija ir viduriavimas.
    • Enteroagregacinė E. coli (EAEC) yra nuolatinio viduriavimo priežastis besivystančiose šalyse. Tikriausiai jis sukelia viduriavimą, nes prilimpa prie plonųjų žarnų gleivinės epitelio ląstelių ir trukdo jų funkcijai.
    • Enteroinvazinis E. coli (EIEC) įsiveržia į storosios žarnos epitelio ląsteles ir sunaikina jas, sukeldamos dizenterijos tipo sindromą, panašų į Shigella paplitęs neišsivysčiusiose šalyse.
    • Enterohemoraginis E. coli (EHEC), pvz E. coli 0157:H7, gamina į šigą panašų toksiną, kuris naikina storosios žarnos epitelio ląsteles, sukelia hemoraginį kolitą, kruviną viduriavimą. Retais atvejais šigatoksinas patenka į kraują ir pernešamas į inkstus, kur, dažniausiai vaikams, pažeidžia kraujagyslių ląsteles ir sukelia hemolizinį ureminį sindromą. E. coli Manoma, kad 0157:H7 per metus JAV sukelia daugiau nei 20 000 infekcijų ir iki 250 mirčių.
    • Difuzinis agregatas E. coli(DAEC) sukelia vandeningą viduriavimą 1–5 metų kūdikiams. Jie skatina plonąsias žarnas dengiančių epitelio ląstelių mikrovilliukų pailgėjimą.
    • Daugiau informacijos: Gramo dėmė iš 6 laboratorijos.
    • „Flash“ animacija, iliustruojanti „Gram“ dėmių reagentų sąveiką molekuliniu lygmeniu &kopija Daniel Cavanaugh, Mark Keen, autoriai, Licencijuota naudoti, ASM MicrobeLibrary.
    • Pabrėžta infekcija: šlapimo takų infekcijos (UTI)

    Atsakymai

    Taip, resuspendavimas apima ląstelių nuosėdų suskaidymą. Tai reiškia, kad ląstelės grąžinamos į tirpalą. Paprastai tai apima mėginio maišymą, o tai nėra tiksliai švelnus, tačiau tame procedūros etape paprastai nėra problemų. Tik pridėjus lizės atsargų reikia pasirūpinti, kad genomo DNR nebūtų susmulkinta.

    BhacSsylan (9522 />) “Puikus atsakymas” (3 />) ScottyMcGeester (1897 />) “Puikus atsakymas” (0 />)

    Tarkime, kad turite DNR granulę. Šį kartą ne ląstelių granulės. Akivaizdu, kad jis labai mažas, bet jūs manote, kad jis yra tūtelėje, kai nuplaunate jį etanoliu. Mano procedūra sako “pašalinkite etanolio perteklių”. Nesu tikras, kaip tai suformuluota, nes nėra tiksliai aišku, ar tai reiškia „pašalinti visą etanolį, kurį naudojote plauti DNR“, ar „pašalinti tik dalį jo“.

    Jau anksčiau gavau rezultatus, bet svarbiausia yra tai, koks yra geriausias būdas pašalinti etanolį išplovus DNR nuosėdas ir suspensiją? Kaip aš įsitikinęs, kad netyčia pipete išėmiau DNR, kai pašalinau etanolį?

    Scotty McGeester (1897 />) “Puikus atsakymas” (0 />)

    Hmm, aš niekada anksčiau neploviau DNR etanoliu, tai keista. Na, kolonas turiu, bet ne granulę. Tačiau apskritai reikia viso to atsikratyti. Etanolis sutrikdys daugumą reakcijų, kurias norėtumėte atlikti su DNR. Norint jo atsikratyti, turbūt geriausias būdas yra pūsti orą, nes jis lengvai išgaruos, bet jūs turite būti atsargūs, kad įsitikintumėte, jog jis tikrai visiškai išnyko.

    BhacSsylan (9522 />) “Puikus atsakymas” (0 />)

    Turinys

    Tipas ir morfologija Redaguoti

    E. coli yra gramneigiamas fakultatyvinis anaerobas (kuris gamina ATP aerobiniu kvėpavimu, jei yra deguonies, bet gali pereiti prie fermentacijos arba anaerobinio kvėpavimo, jei deguonies nėra) ir nesporuliuojanti bakterija. [17] Ląstelės paprastai yra lazdelės formos, apie 2,0 μm ilgio ir 0,25–1,0 μm skersmens, o ląstelių tūris yra 0,6–0,7 μm 3 . [18] [19] [20]

    E. coli nudažo gramneigiamus, nes jo ląstelės sienelę sudaro plonas peptidoglikano sluoksnis ir išorinė membrana. Dažymo proceso metu, E. coli įgauna priešdažo safranino spalvą ir nusidažo rausvai. Išorinė membrana, supanti ląstelės sienelę, sukuria barjerą tam tikriems antibiotikams, pvz E. coli nėra pažeistas penicilino. [15]

    Padermės, turinčios žvynelių, yra judrios. Žvyneliai turi peritrichinį išsidėstymą. [21] Jis taip pat prisitvirtina ir nusivalo prie žarnyno mikrovillių per sukibimo molekulę, žinomą kaip intiminas. [22]

    Metabolizmas Redaguoti

    E. coli gali gyventi ant įvairių substratų ir naudoja mišrią rūgštinę fermentaciją anaerobinėmis sąlygomis, gamindama laktatą, sukcinatą, etanolį, acetatą ir anglies dioksidą. Kadangi daugelis mišrios rūgščių fermentacijos būdų gamina vandenilio dujas, šiems būdams reikia, kad vandenilio kiekis būtų žemas, kaip yra E. coli gyvena kartu su vandenilį vartojančiais organizmais, tokiais kaip metanogenai ar sulfatus redukuojančios bakterijos. [23]

    Papildomai, E. coli“s metabolizmą galima pakeisti naudojant tik CO2 kaip anglies šaltinis biomasės gamybai. Kitaip tariant, šis privalomas heterotrofo metabolizmas gali būti pakeistas, kad būtų rodomos autotrofinės galimybės, heterologiškai išreiškiant anglies fiksavimo genus, taip pat formiato dehidrogenazę ir atliekant laboratorinius evoliucijos eksperimentus. Tai galima padaryti naudojant formiatą, siekiant sumažinti elektronų nešiklius ir tiekti ATP, reikalingą anaboliniams keliams šių sintetinių autotrofų viduje. [24]

    E. coli turi tris natūralius glikolizės būdus: EMPP, EDP ir OPPP. EMPP naudoja dešimt fermentinių žingsnių, kad gautų du piruvatus, du ATP ir du NADH vienai gliukozės molekulei, o OPPP yra NADPH sintezės oksidacijos kelias. Nors EDP yra termodinamiškai palankesnis iš trijų būdų, E. coli nenaudokite EDP gliukozės metabolizmui, daugiausia pasikliaudami EMPP ir OPPP. EDP ​​daugiausia išlieka neaktyvus, išskyrus augimo su gliukonatu metu. [25]

    Katabolito represijos Redaguoti

    Augindamos cukrų mišinį, bakterijos dažnai suvartoja cukrų paeiliui per procesą, žinomą kaip katabolitų slopinimas. Slopindamos genų, susijusių su mažiau pageidaujamų cukrų metabolizmu, ekspresiją, ląstelės paprastai pirmiausia sunaudos didžiausią augimo greitį duodantį cukrų, po to cukrų, kurio augimo greitis yra kitas ir t.t. Tai darydamos ląstelės užtikrina, kad jų riboti medžiagų apykaitos ištekliai būtų naudojami siekiant padidinti augimo greitį. Gerai naudojamas pavyzdys su E. coli apima bakterijos augimą ant gliukozės ir laktozės, kur E. coli gliukozę suvartos prieš laktozę. Katabolito represijos taip pat buvo pastebėtos E.coli esant kitiems negliukozės cukrams, tokiems kaip arabinozė ir ksilozė, sorbitolis, ramnozė ir ribozė. Į E. coli, gliukozės katabolito slopinimą reguliuoja fosfotransferazės sistema, daugelio baltymų fosforilinimo kaskada, susiejanti gliukozės įsisavinimą ir metabolizmą. [26]

    Kultūros augimas Redaguoti

    Optimalus augimas E. coli įvyksta 37 °C (98,6 °F) temperatūroje, tačiau kai kurios laboratorinės padermės gali daugintis iki 49 °C (120 °F) temperatūroje. [27] E. coli auga įvairiose apibrėžtose laboratorinėse terpėse, tokiose kaip lizogeninis sultinys arba bet kokia terpė, kurioje yra gliukozės, vienbazio amonio fosfato, natrio chlorido, magnio sulfato, dvibazio kalio fosfato ir vandens. Augimą gali paskatinti aerobinis arba anaerobinis kvėpavimas, naudojant daugybę redokso porų, įskaitant piruvinės rūgšties, skruzdžių rūgšties, vandenilio ir aminorūgščių oksidaciją ir substratų, tokių kaip deguonis, nitratai, fumaratas, dimetilsulfoksidas, redukciją, ir trimetilamino N-oksidas. [28] E. coli yra klasifikuojamas kaip fakultatyvinis anaerobas. Jis naudoja deguonį, kai jo yra ir yra. Tačiau jis gali toliau augti, kai nėra deguonies, naudojant fermentaciją arba anaerobinį kvėpavimą. Galimybė toliau augti, kai nėra deguonies, yra bakterijų pranašumas, nes jų išgyvenimas padidėja aplinkoje, kurioje vyrauja vanduo. [15]

    Ląstelių ciklas Redaguoti

    Bakterijų ląstelių ciklas yra padalintas į tris etapus. B laikotarpis įvyksta tarp ląstelių dalijimosi pabaigos ir DNR replikacijos pradžios. C periodas apima laiką, kurio reikia chromosomų DNR replikacijai. D laikotarpis reiškia etapą tarp DNR replikacijos pabaigos ir ląstelių dalijimosi pabaigos. [29] Padvigubinimo norma E. coli yra didesnis, kai yra daugiau maistinių medžiagų. Tačiau C ir D periodų trukmė nesikeičia net tada, kai padvigubėjimo laikas tampa mažesnis už C ir D periodų sumą. Esant sparčiausiam augimo greičiui, replikacija prasideda dar nepasibaigus ankstesniam replikacijos etapui, todėl išilgai DNR susidaro daug replikacijos šakių ir sutampa ląstelių ciklai. [30]

    Replikacijos šakių skaičius sparčiai auga E. coli paprastai seka 2n (n = 1, 2 arba 3). Taip atsitinka tik tuo atveju, jei replikacija pradedama vienu metu iš visų replikacijų šaltinių ir yra vadinama sinchroniniu replikavimu. Tačiau ne visos ląstelės kultūroje replikuojasi sinchroniškai. Šiuo atveju ląstelės neturi dviejų replikacijos šakių kartotinių. Tada replikacijos inicijavimas vadinamas asinchroniniu. [31] Tačiau asinchroniją gali sukelti, pavyzdžiui, DnaA [31] arba DnaA iniciatorių susiejančio baltymo DiaA mutacijos. [32]

    Genetinė adaptacija Redaguoti

    E. coli ir susijusios bakterijos turi galimybę perkelti DNR per bakterijų konjugaciją arba transdukciją, o tai leidžia genetinei medžiagai plisti horizontaliai per esamą populiaciją. Transdukcijos procese, kuriame naudojamas bakterinis virusas, vadinamas bakteriofagu [33], genas, koduojantis Shiga toksiną, plinta iš Shigella bakterijos į E. coli padėjo gaminti E. coli O157:H7, Shiga toksiną gaminanti padermė E. coli.

    E. coli apima didžiulę bakterijų populiaciją, kuri pasižymi labai dideliu genetinės ir fenotipinės įvairovės laipsniu. Daugelio izoliatų genomo sekos nustatymas E. coli ir susijusios bakterijos rodo, kad būtų pageidautina taksonominis perklasifikavimas. Tačiau tai nebuvo padaryta, daugiausia dėl jo medicininės svarbos [34] ir E. coli išlieka viena iš pačių įvairiausių bakterijų rūšių: tik 20% genų tipinėje E. coli genomas yra bendras tarp visų padermių. [35]

    Tiesą sakant, konstruktyvesniu požiūriu, genties nariai Shigella (S. dysenteriae, S. flexneri, S. boydii, ir S. sonnei) turėtų būti klasifikuojami kaip E. coli štamai, reiškinys, vadinamas užmaskuotais taksonais. [36] Panašiai, kitos atmainos E. coli (pvz., K-12 padermė, dažniausiai naudojama rekombinantinės DNR darbe) yra pakankamai skirtingos, kad jas reikėtų perklasifikuoti.

    Padermė yra rūšies pogrupis, turintis unikalių savybių, išskiriančių ją iš kitų padermių. Šie skirtumai dažnai aptinkami tik molekuliniu lygmeniu, tačiau dėl jų gali pasikeisti bakterijos fiziologija arba gyvavimo ciklas. Pavyzdžiui, štamas gali įgyti patogeniškumo, galimybę naudoti unikalų anglies šaltinį, gebėjimą užimti tam tikrą ekologinę nišą arba gebėjimą atsispirti antimikrobinėms medžiagoms. Įvairios atmainos E. coli dažnai yra būdingi šeimininkui, todėl aplinkos mėginiuose galima nustatyti išmatų užterštumo šaltinį. [12] [13] Pavyzdžiui, žinant, kuris E. coli Padermės, esančios vandens mėginyje, leidžia tyrėjams daryti prielaidas, ar užteršimą sukėlė žmogus, kitas žinduolis ar paukštis.

    Serotipai Redaguoti

    Bendra padalijimo sistema E. coli, bet neparemtas evoliuciniu ryšiu, yra pagal serotipą, kuris yra pagrįstas pagrindiniais paviršiaus antigenais (O antigenas: lipopolisacharido sluoksnio H dalis: flagellino K antigenas: kapsulė), pvz. O157:H7). [37] Tačiau įprasta cituoti tik serogrupę, ty O-antigeną. Šiuo metu žinoma apie 190 serogrupių. [38] Įprasta laboratorinė padermė turi mutaciją, kuri neleidžia susidaryti O-antigenui, todėl nėra tipizuojama.

    Genomo plastiškumas ir evoliucija Redaguoti

    Kaip ir visos gyvybės formos, naujos atmainos E. coli vystosi per natūralius biologinius mutacijos, genų dubliavimosi ir horizontalaus genų perdavimo procesus, 18% laboratorinės padermės MG1655 genomo buvo įgyta horizontaliai, nes skiriasi nuo Salmonella. [39] E. coli K-12 ir E. coli Laboratoriniams tikslams dažniausiai naudojamos B padermės. Kai kurios padermės turi savybių, kurios gali būti kenksmingos šeimininkui. Šios virulentiškos padermės paprastai sukelia viduriavimą, kuris sveikiems suaugusiems dažnai praeina savaime, bet dažnai yra mirtinas besivystančių šalių vaikams. [40] Virulentiškesnės padermės, tokios kaip O157:H7, sukelia sunkias ligas arba mirtį vyresnio amžiaus žmonėms, labai jauniems žmonėms arba žmonėms, kurių imunitetas nusilpęs. [40] [41]

    Gentys Escherichia ir Salmonella skyrėsi maždaug prieš 102 milijonus metų (patikimumo intervalas: 57–176 mya), o tai sutampa su jų šeimininkų skirtumais: pirmieji randami žinduoliams, o antrieji – paukščiams ir ropliams. [42] Po to sekė an skilimas Escherichia protėvis į penkias rūšis (E. Albertii, E. coli, E. fergusonii, E. hermannii, ir E. vulneris). Paskutinis E. coli protėvis suskilo prieš 20–30 milijonų metų. [43]

    Ilgalaikiai evoliucijos eksperimentai naudojant E. coli1988 m. pradėtas Richardas Lenskis leido laboratorijoje tiesiogiai stebėti genomo evoliuciją per daugiau nei 65 000 kartų. [44] Pavyzdžiui, E. coli paprastai neturi galimybės augti aerobiškai naudojant citratą kaip anglies šaltinį, kuris naudojamas kaip diagnostikos kriterijus, pagal kurį galima atskirti E. coli nuo kitų, glaudžiai susijusių bakterijų, tokių kaip Salmonella. Šiame eksperimente viena populiacija iš E. coli netikėtai išsivystė gebėjimas aerobiškai metabolizuoti citratą, o tai yra pagrindinis evoliucinis pokytis, turintis tam tikrų mikrobų specifikos požymių.

    Mikrobų pasaulyje galima nustatyti plėšrūnų ryšį, panašų į tą, kuris stebimas gyvūnų pasaulyje. Atsižvelgta, buvo pastebėta, kad E. coli yra daugelio generalistinių plėšrūnų, tokių kaip Myxococcus xanthus. Šiuose plėšrūnų ir grobio santykiuose stebima lygiagreti abiejų rūšių evoliucija dėl genominių ir fenotipinių modifikacijų, kai E.coli modifikacijos modifikuojamos dviem aspektais, susijusiais su jų virulentiškumu, pvz., gleivių gamyba (pernelyg didelė egzoplazminės rūgšties alginato gamyba) ir OmpT geno slopinimu, todėl ateities kartoms geriau prisitaiko viena iš rūšių, kuriai evoliucija neutralizuoja. iš kitos – vadovaujantis koevoliuciniu modeliu, parodytu Raudonosios karalienės hipoteze. [45]

    Neotipo padermė Redaguoti

    E. coli yra genties tipo rūšis (Escherichia) ir savo ruožtu Escherichia yra Enterobacteriaceae šeimos tipo gentis, kur šeimos pavadinimas nėra kilęs iš genties Enterobacter + "i" (sic.) + "aceae", bet iš "enterobacterium" + "aceae" (enterobakterija nėra gentis, o alternatyvus trivialus enterinės bakterijos pavadinimas). [46] [47]

    Manoma, kad pradinė Escherich aprašyta padermė buvo prarasta, todėl kaip atstovas buvo pasirinktas naujo tipo štamas (neotipas): neotipo padermė yra U5/41 T , [48] taip pat žinomas depozito pavadinimais DSM 30083, [49]. ATCC 11775, [50] ir NCTC 9001, [51], kuris yra patogeniškas viščiukams ir turi O1:K1:H7 serotipą. [52] Tačiau daugumoje tyrimų O157:H7, K-12 MG1655 arba K-12 W3110 buvo naudojami kaip reprezentatyvūs. E. coli. Tipo padermės genomas buvo sekvenuotas tik neseniai. [48]

    Filogenija iš E. coli padermės Redaguoti

    Daugelis šiai rūšiai priklausančių padermių buvo išskirtos ir apibūdintos. Be serotipo (vide supra), jie gali būti klasifikuojami pagal jų filogeniją, ty numanomą evoliucijos istoriją, kaip parodyta toliau, kur rūšys suskirstytos į šešias grupes. [53] [54] Visų pirma naudojant visas genomo sekas, gaunamos labai palaikomos filogenijos. Remiantis tokiais duomenimis, penki porūšiai E. coli buvo išskirti. [48]

    Ryšys tarp filogenetinio atstumo („giminystės“) ir patologijos yra nedidelis, [48] pvz. O157:H7 serotipo padermės, sudarančios kladą („išskirtinė grupė“) – toliau nurodyta E grupė – yra enterohemoraginės padermės (EHEC), tačiau ne visos EHEC padermės yra glaudžiai susijusios. Tiesą sakant, keturios skirtingos rūšys Shigella yra įterpti tarp E. coli padermės (vide supra), tuo tarpu E. Albertii ir E. fergusonii yra už šios grupės ribų. Tikrai, visi Shigella rūšys buvo įtrauktos į vieną porūšį E. coli filogenominiame tyrime, kuris apėmė tipo štamą, [48] ir dėl šios priežasties sunku atitinkamai perklasifikuoti. Visos dažniausiai naudojamos tyrimų atmainos E. coli priklauso A grupei ir daugiausia yra kilę iš Clifton's K-12 padermės (λ + F + O16) ir mažesniu laipsniu iš d'Herelle's. Bacillus coli padermė (B padermė) (O7).

    E. coli S88 (O45:K1. Ekstraląstelinis patogeninis)

    E. coli UMN026 (O17:K52:H18. Ekstraląstelinis patogeninis)

    E. coli (O19:H34. Ekstraląstelinis patogeninis)

    E. coli (O7:K1. Ekstraląstelinis patogeninis)

    E. coli GOS1 (O104:H4 EAHEC) Vokietijos 2011 m. protrūkis

    E. coli ATCC8739 (O146. Crook's E.coli, naudotas fagų darbe XX a. šeštajame dešimtmetyje)

    E. coli K-12 W3110 (O16. λ − F – „laukinio tipo“ molekulinės biologijos padermė)

    E. coli K-12 DH10b (O16. didelės elektrokompetencijos molekulinės biologijos padermė)

    E. coli K-12 DH1 (O16. aukštos cheminės kompetencijos molekulinės biologijos padermė)

    E. coli K-12 MG1655 (O16. λ − F – „laukinio tipo“ molekulinės biologijos padermė)

    E. coli BW2952 (O16. kompetentinga molekulinės biologijos padermė)

    E. coli B REL606 (O7. aukštos kompetencijos molekulinės biologijos padermė)

    E. coli BL21-DE3 (O7 ekspresijos molekulinės biologijos padermė su T7 polimeraze, skirta pET sistemai)

    Pirmoji pilna DNR seka an E. coli genomas (laboratorinė padermė K-12 darinys MG1655) buvo paskelbtas 1997 m. Tai žiedinė 4,6 mln. bazinių porų ilgio DNR molekulė, turinti 4288 anotuotus baltymus koduojančius genus (sutvarkytus į 2584 operonus), septynis ribosominės RNR (rRNR) operonus, ir 86 perdavimo RNR (tRNR) genai. Nepaisant to, kad apie 40 metų buvo intensyvios genetinės analizės objektas, daugelis šių genų anksčiau nebuvo žinomi. Nustatyta, kad kodavimo tankis yra labai didelis, o vidutinis atstumas tarp genų yra tik 118 bazinių porų. Pastebėta, kad genome yra daug perkeliamų genetinių elementų, pasikartojančių elementų, paslaptingų profagų ir bakteriofagų liekanų. [55]

    Daugiau nei trys šimtai pilnų genominių sekų Escherichia ir Shigella rūšys žinomos. Tipo padermės genomo seka E. coli buvo įtrauktas į šią kolekciją iki 2014 m. [48] Palyginus šias sekas, matyti, kad labai didelė įvairovė, tik apie 20 % kiekvieno genomo sudaro sekas, esančias kiekviename iš izoliatų, o apie 80 % kiekvieno genomo gali skirtis tarp izoliatų. [35] Kiekviename atskirame genome yra nuo 4000 iki 5500 genų, tačiau bendras skirtingų genų skaičius tarp visų sekvenuotų E. coli padermių (pangenomas) viršija 16 000. Ši labai didelė sudedamųjų genų įvairovė buvo aiškinama taip, kad du trečdaliai E. coli pangenomas kilo iš kitų rūšių ir atkeliavo per horizontalaus genų perdavimo procesą. [56]

    Genai viduje E. coli paprastai yra pavadinti 4 raidžių akronimais, kylančiais iš jų funkcijos (kai žinoma), ir kursyvu. Pavyzdžiui, recA yra pavadintas pagal savo vaidmenį homologinėje rekombinacijoje ir raidė A. Funkciškai susiję genai yra pavadinti recB, recC, recD ir tt Baltymai įvardijami didžiosiomis raidėmis, pvz. RecA, RecB ir tt Kai genomas E. coli buvo sekvenuota, visi genai buvo sunumeruoti (daugiau ar mažiau) jų tvarka genome ir sutrumpinti b skaičiais, pvz., b2819 (= recD). Vardai „b“ buvo sukurti Fredo vardu Blattner, kuris vadovavo genomo sekos pastangoms. [55] Įvesta kita numeravimo sistema su kitos seka E. coli padermė, W3110, kuri buvo sekvenuota Japonijoje ir todėl naudoja skaičius, prasidedančius JW. (Japanietis W3110), pvz. JW2787 (= recD). [57] Taigi, recD = b2819 = JW2787. Tačiau atkreipkite dėmesį, kad dauguma duomenų bazių turi savo numeravimo sistemą, pvz. EcoGene duomenų bazėje [58] naudojama EG10826 recD. Galiausiai, ECK numeriai yra specialiai naudojami MG1655 padermės alelams E. coli K-12. [58] Išsamų genų ir jų sinonimų sąrašus galima gauti iš tokių duomenų bazių kaip EcoGene arba Uniprot.

    Proteome Redaguoti

    Keletas tyrimų ištyrė proteomą E. coli. Iki 2006 m. eksperimentiškai buvo nustatyti 1 627 (38 %) iš 4 237 atvirų skaitymo rėmų (ORF). [59] Pateikiama Escherichia coli K-12 4 639 221 bazių poros seka. Iš 4288 anotuotų baltymus koduojančių genų 38 procentai neturi priskirtos funkcijos. Palyginimas su kitais penkiais sekvenuotais mikrobais atskleidžia visur esančias ir siaurai paskirstytas genų šeimas, kuriose yra daug panašių genų šeimų. E. coli taip pat akivaizdūs. Didžiausioje paraloginių baltymų šeimoje yra 80 ABC transporterių. Visas genomas yra stebėtinai organizuotas atsižvelgiant į vietinę replikacijos kryptį guaninai, oligonukleotidai, galbūt susiję su replikacija ir rekombinacija, ir dauguma genų yra taip orientuoti. Genome taip pat yra įterpimo sekos (IS) elementų, fagų liekanų ir daug kitų neįprastos sudėties dėmių, rodančių genomo plastiškumą per horizontalų perkėlimą. [55]

    Interactome Redaguoti

    Sąveika su E. coli buvo tiriamas afiniteto gryninimo ir masės spektrometrijos (AP/MS) metodu bei analizuojant dvejetainę jo baltymų sąveiką.

    Baltymų kompleksai. 2006 m. atliktas tyrimas išgrynino 4339 baltymus iš K-12 padermės kultūrų ir rado sąveikaujančius partnerius 2667 baltymams, kurių daugelis tuo metu turėjo nežinomas funkcijas. [60] 2009 m. atliktas tyrimas nustatė 5 993 to paties baltymo sąveiką E. coli įtampa, nors šie duomenys mažai sutampa su 2006 m. leidinio duomenimis. [61]

    Dvejetainės sąveikos. Rajagopala ir kt. (2014) atliko sisteminius mielių dviejų hibridų ekranus su dauguma E. coli baltymų, ir iš viso nustatė 2234 baltymų ir baltymų sąveikas. [62] Šiame tyrime taip pat buvo integruotos genetinės sąveikos ir baltymų struktūros bei 227 baltymų kompleksuose užfiksuotos 458 sąveikos.

    E. coli priklauso bakterijų grupei, neoficialiai vadinamai koliforminėmis bakterijomis, kurios randamos šiltakraujų gyvūnų virškinimo trakte. [63] E. coli paprastai kolonizuoja kūdikio virškinamąjį traktą per 40 valandų nuo gimimo, su maistu ar vandeniu arba vaiką prižiūrinčių asmenų. žarnyne, E. coli prilimpa prie storosios žarnos gleivių. Tai yra pagrindinis fakultatyvinis žmogaus virškinimo trakto anaerobas. [64] (Fakultatyviniai anaerobai – tai organizmai, galintys augti tiek esant deguoniui, tiek be jo.) Kol šios bakterijos neįgyja genetinių elementų, koduojančių virulentiškumo faktorius, jos išlieka gerybiniais komensalais. [65]

    Terapinis naudojimas Redaguoti

    Dėl mažų sąnaudų ir greičio, kurį galima auginti ir modifikuoti laboratorijoje, E. coli yra populiari ekspresijos platforma rekombinantinių baltymų, naudojamų terapijoje, gamybai. Vienas privalumas naudojant E. coli per kitą išraiškos platformą yra tai E. coli natūraliai neeksportuoja į periplazmą daug baltymų, todėl lengviau atgauti dominantį baltymą be kryžminio užteršimo. [66] E. coli K-12 padermės ir jų dariniai (DH1, DH5α, MG1655, RV308 ir W3110) yra plačiausiai biotechnologijų pramonėje naudojamos padermės. [67] Nepatogeniškas E. coli padermė Nissle 1917 (EcN), (Mutaflor) ir E. coli O83:K24:H31 (Colinfant) [68] [69] ) naudojami kaip probiotikai medicinoje, daugiausia įvairių virškinimo trakto ligų, [70] įskaitant uždegimines žarnyno ligas, gydymui. [71] Manoma, kad EcN padermė gali trukdyti augti oportunistiniams patogenams, įskaitant Salmonella ir kiti koliforminiai enteropatogenai, gaminant mikrocino baltymus, gamina sideroforus. [72]

    Dauguma E. coli padermės nesukelia ligų, natūraliai gyvena žarnyne [73], tačiau virulentiškos padermės gali sukelti gastroenteritą, šlapimo takų infekcijas, naujagimių meningitą, hemoraginį kolitą ir Krono ligą. Dažni požymiai ir simptomai yra stiprūs pilvo spazmai, viduriavimas, hemoraginis kolitas, vėmimas ir kartais karščiavimas. Retesniais atvejais virulentiškos padermės taip pat sukelia žarnyno nekrozę (audinių mirtį) ir perforaciją, neprogresuojant į hemolizinį-ureminį sindromą, peritonitą, mastitą, sepsį ir gramneigiamą pneumoniją. Labai maži vaikai yra labiau linkę susirgti sunkiomis ligomis, tokiomis kaip hemolizinis ureminis sindromas, tačiau bet kokio amžiaus sveikiems asmenims gresia sunkios pasekmės, kurios gali kilti dėl užsikrėtimo E. coli. [64] [74] [75] [76]

    Kai kurios atmainos E. coli, pavyzdžiui, O157:H7, gali gaminti Shiga toksiną (klasifikuojamą kaip bioterorizmo agentas). Shiga toksinas sukelia uždegiminius atsakus tikslinėse žarnyno ląstelėse, palikdamas pažeidimus, dėl kurių atsiranda kruvinas viduriavimas, kuris yra Shiga toksiną gaminančio simptomas. E. coli (STEC) infekcija. Šis toksinas dar labiau sukelia priešlaikinį raudonųjų kraujo kūnelių sunaikinimą, kurie vėliau užkemša organizmo filtravimo sistemą, inkstus, kai kuriais retais atvejais (dažniausiai vaikams ir pagyvenusiems žmonėms) sukelia hemolizinį-ureminį sindromą (HUS), kuris gali sukelti inkstų nepakankamumą. ir net mirtį. Hemolizinio ureminio sindromo požymiai yra sumažėjęs šlapinimasis, letargija, skruostų ir apatinių vokų blyškumas. 25% sergančiųjų HUS atsiranda nervų sistemos komplikacijų, kurios savo ruožtu sukelia insultą. Be to, ši įtampa sukelia skysčių kaupimąsi (nes neveikia inkstai), todėl aplink plaučius, kojas ir rankas atsiranda edema. Šis padidėjęs skysčių kaupimasis, ypač aplink plaučius, trukdo širdies veiklai, todėl padidėja kraujospūdis. [77] [22] [78] [79] [80] [75] [76]

    Uropatogeninis E. coli (UPEC) yra viena iš pagrindinių šlapimo takų infekcijų priežasčių. [81] Jis yra normalios žarnyno mikrobiotos dalis ir gali būti įvedamas įvairiais būdais. Ypatingai patelėms valymas po tuštinimosi (šluostymas atgal į priekį) gali sukelti urogenitalinės angos užteršimą išmatomis. Analinis lytinis aktas taip pat gali įnešti šios bakterijos į vyrų šlaplę, o pereinant nuo analinio prie makšties, vyras taip pat gali įnešti UPEC į moters urogenitalinę sistemą.

    Enterotoksigeninis E. coli (ETEC) yra dažniausia keliautojų viduriavimo priežastis – kiekvienais metais besivystančiose šalyse pasaulyje užregistruojama net 840 mln. Bakterijos, paprastai perduodamos per užterštą maistą ar geriamąjį vandenį, prilimpa prie žarnyno gleivinės, kur išskiria vieną iš dviejų tipų enterotoksinų, dėl kurių atsiranda vandeningas viduriavimas. Infekcijų dažnis ir sunkumas yra didesnis tarp vaikų iki penkerių metų, įskaitant net 380 000 mirčių kasmet. [82]

    2011 metų gegužės mėnesį vienas E. coli padermė, O104:H4, buvo Vokietijoje prasidėjusio bakterijų protrūkio objektas. Tam tikros atmainos E. coli yra pagrindinė per maistą plintančių ligų priežastis. Protrūkis prasidėjo, kai keli žmonės Vokietijoje užsikrėtė enterohemoragine liga E. coli (EHEC) bakterijų, sukeliančių hemolizinį-ureminį sindromą (HUS), skubią medicinos pagalbą, kurią reikia skubiai gydyti. Protrūkis apėmė ne tik Vokietiją, bet ir 15 kitų šalių, įskaitant Šiaurės Amerikos regionus. [83] 2011 m. birželio 30 d. vokiečių k Bundesinstitut für Risikobewertung (BfR) (Federalinis rizikos vertinimo institutas, federalinis institutas prie Vokietijos federalinės maisto, žemės ūkio ir vartotojų apsaugos ministerijos) paskelbė, kad ožragės sėklos iš Egipto greičiausiai buvo EHEC protrūkio priežastis. [84]

    Kai kurie tyrimai parodė, kad nėra E.coli tiriamųjų, sergančių medžiagų apykaitos sutrikimu fenilketonurija, žarnyno floroje. Yra hipotezė, kad šių normalių bakterijų nebuvimas sutrikdo pagrindinių vitaminų B gamybą2 (riboflavinas) ir K2 (menachinonas) - vitaminai, kurie yra susiję su daugeliu fiziologinių žmonių vaidmenų, tokių kaip ląstelių ir kaulų metabolizmas, ir taip prisideda prie sutrikimo. [85]

    Inkubacinis laikotarpis Redaguoti

    Laikas nuo STEC bakterijų nurijimo iki pykinimo vadinamas „inkubaciniu periodu“. Inkubacinis laikotarpis paprastai trunka 3–4 dienas po poveikio, tačiau gali trukti net 1 dieną arba 10 dienų. Simptomai dažnai prasideda lėtai nuo lengvo pilvo skausmo arba viduriavimo be kraujo, kuris pablogėja per kelias dienas. HUS, jei atsiranda, išsivysto vidutiniškai 7 dienas po pirmųjų simptomų, kai viduriavimas gerėja. [86]

    Diagnozė Redaguoti

    Infekcinio viduriavimo diagnozė ir atsparumo antimikrobinėms medžiagoms nustatymas atliekami naudojant išmatų kultūrą, o vėliau – jautrumo antibiotikams tyrimą. Virškinimo trakto patogenams kultivuoti reikia mažiausiai 2 dienų ir daugiausia kelių savaičių. Išmatų kultūros jautrumo (tikras teigiamas) ir specifiškumo (tikras neigiamas) rodikliai skiriasi priklausomai nuo patogeno, nors daugelio žmonių patogenų kultivuoti negalima. Jei mėginiai yra teigiami, atsparumo antimikrobinėms medžiagoms tyrimas užtrunka dar 12–24 valandas.

    Dabartinį priežiūros tašką galima nustatyti atliekant molekulinės diagnostikos testus E. coli ir antimikrobinis atsparumas nustatytose padermėse daug greičiau nei kultūros ir jautrumo tyrimai. „Microarray“ pagrindu sukurtos platformos gali nustatyti konkrečias patogenines padermes E. coli ir E. coli- specifiniai AMR genai per dvi valandas ar mažiau, pasižymintys dideliu jautrumu ir specifiškumu, tačiau tyrimo grupės dydis (t. y. visų patogenų ir atsparumo antimikrobinėms medžiagoms genai) yra ribotas. Šiuo metu kuriamos naujesnės metagenomika pagrįstos infekcinių ligų diagnostikos platformos, siekiant įveikti įvairius kultūros ir visų šiuo metu turimų molekulinės diagnostikos technologijų apribojimus.

    Gydymas Redaguoti

    Pagrindinis gydymo būdas yra dehidratacijos įvertinimas ir skysčių bei elektrolitų pakeitimas. Nustatyta, kad antibiotikų vartojimas sutrumpina ligos eigą ir enterotoksigeninių medžiagų išsiskyrimo trukmę. E. coli (ETEC) suaugusiesiems endeminėse vietovėse ir keliautojų viduriavimu, nors atsparumo dažnai vartojamiems antibiotikams rodiklis didėja ir jie paprastai nerekomenduojami. [87] Naudojamas antibiotikas priklauso nuo jautrumo konkrečiame geografiniame regione. Šiuo metu pasirenkami antibiotikai yra fluorokvinolonai arba azitromicinas, o rifaksiminas turi vis didesnį vaidmenį. Geriamasis rifaksiminas, pusiau sintetinis rifamicino darinys, yra veiksmingas ir gerai toleruojamas antibakterinis preparatas, skirtas suaugusiųjų, sergančių neinvaziniu keliautojų viduriavimu, gydymui. Rifaksiminas buvo žymiai veiksmingesnis už placebą ir ne mažiau veiksmingas už ciprofloksaciną, sumažindamas viduriavimo trukmę. Nors rifaksiminas yra veiksmingas pacientams, sergantiems E. coli-vyraujantis keliautojų viduriavimas, jis atrodo neveiksmingas pacientams, užsikrėtusiems uždegiminiais ar invaziniais enteropatogenais. [88]

    Prevencija Redaguoti

    ETEC yra tipas E. coli į kurią daugiausia dėmesio skiriama kuriant vakcinas. Antikūnai prieš LT ir pagrindinius ETEC CF suteikia apsaugą nuo LT gaminančių, ETEC ekspresuojančių homologinių CF. Sukurtos geriamosios inaktyvuotos vakcinos, susidedančios iš toksino antigeno ir ištisų ląstelių, t. y. licencijuota rekombinantinė choleros B subvieneto (rCTB)-WC vakcina nuo choleros Dukoral. Šiuo metu nėra licencijuotų ETEC vakcinų, nors kelios jų yra skirtinguose vystymosi etapuose. [89] Skirtingų tyrimų metu rCTB-WC vakcina nuo choleros suteikė didelę (85–100 %) trumpalaikę apsaugą. Kandidatas į geriamąją ETEC vakciną, sudarytas iš rCTB ir inaktyvuoto formalino E. coli Klinikiniais tyrimais įrodyta, kad bakterijos, išreiškiančios pagrindines CF, yra saugios, imunogeniškos ir veiksmingos nuo sunkaus viduriavimo amerikiečiams keliautojams, bet ne nuo ETEC viduriavimo mažiems vaikams Egipte. Modifikuota ETEC vakcina, sudaryta iš rekombinantinės E. coli padermių, kurios per daug ekspresuoja pagrindinius CF, ir labiau į LT panašų hibridinį toksoidą, vadinamą LCTBA, atliekami klinikiniai tyrimai. [90] [91]

    Kiti patvirtinti prevencijos metodai E. coli plitimas apima rankų plovimą ir geresnes sanitarines sąlygas bei geriamąjį vandenį, nes užsikrečiama užteršto maisto ir vandens atsargų išmatomis.Be to, kruopštus mėsos kepimas ir žalių, nepasterizuotų gėrimų, tokių kaip sultys ir pienas, vartojimo vengimas yra kiti patikimi būdai užkirsti kelią. E.coli. Galiausiai, gamindami maistą venkite kryžminio indų ir darbo vietų užteršimo. [92]

    Dėl ilgos laboratorinės kultūros istorijos ir lengvo manipuliavimo, E. coli vaidina svarbų vaidmenį šiuolaikinėje biologinėje inžinerijoje ir pramoninėje mikrobiologijoje. [93] Stanley Norman Cohen ir Herbert Boyer darbas E. coli, naudojant plazmides ir restrikcijos fermentus rekombinantinei DNR sukurti, tapo biotechnologijos pagrindu. [94]

    E. coli yra labai universalus šeimininkas heterologiniams baltymams gaminti, [95] ir buvo sukurtos įvairios baltymų ekspresijos sistemos, leidžiančios gaminti rekombinantinius baltymus. E. coli. Tyrėjai gali įvesti genus į mikrobus, naudodami plazmides, kurios leidžia aukšto lygio baltymų ekspresiją, ir toks baltymas gali būti masiškai gaminamas pramoninės fermentacijos procesuose. Vienas iš pirmųjų naudingų rekombinantinės DNR technologijos pritaikymų buvo manipuliavimas E. coli gaminti žmogaus insuliną. [96]

    Daugelis baltymų, kurie anksčiau buvo laikomi sunkiai arba neįmanomu išreikšti E. coli sulankstyta forma buvo sėkmingai išreikšti E. coli. Pavyzdžiui, baltymai su daugybe disulfidinių jungčių gali būti gaminami periplazminėje erdvėje arba mutantų citoplazmoje, kurios yra pakankamai oksiduojančios, kad susidarytų disulfidiniai ryšiai [97], o baltymai, kuriems reikalingas posttransliacinis modifikavimas, pvz., glikozilinimas, siekiant stabilumo ar funkcijos, turi. buvo išreikštas naudojant N-susietą glikozilinimo sistemą Campylobacter jejuni suprojektuotas į E. coli. [98] [99] [100]

    Modifikuota E. coli ląstelės buvo naudojamos vakcinų kūrimui, bioremediacijai, biokuro gamybai, [101] apšvietimui ir imobilizuotų fermentų gamybai. [95] [102]

    Padermė K-12 yra mutantinė forma E. coli kuris per daug išreiškia fermentą šarminę fosfatazę (ALP). [103] Mutacija atsiranda dėl geno, nuolat koduojančio fermentą, defekto. Teigiama, kad genas, gaminantis produktą be jokio slopinimo, turi konstitucinį aktyvumą. Ši konkreti mutantų forma naudojama aukščiau minėtam fermentui išskirti ir išgryninti. [103]

    Padermė OP50 Escherichia coli naudojamas priežiūrai Caenorhabditis elegantiškas kultūros.

    JM109 padermė yra mutantinė forma E. coli tai yra recA ir endA trūkumas. Padermė gali būti naudojama mėlynai baltai atrankai, kai ląstelės turi vaisingumo faktoriaus epizodą [104] Trūkstant recA, sumažėja nepageidaujamo dominančios DNR apribojimo galimybė, o endA trūkumas slopina plazmidės DNR skilimą. Taigi JM109 yra naudingas klonavimo ir ekspresijos sistemoms.

    Modelinis organizmas Redaguoti

    E. coli mikrobiologijos tyrimuose dažnai naudojamas kaip pavyzdinis organizmas. Kultivuojamos veislės (pvz. E. coli K12) yra gerai prisitaikę prie laboratorinės aplinkos ir, skirtingai nei laukinio tipo padermės, prarado gebėjimą klestėti žarnyne. Daugelis laboratorinių padermių praranda gebėjimą formuoti bioplėveles. [105] [106] Šios savybės apsaugo laukinio tipo padermes nuo antikūnų ir kitų cheminių atakų, tačiau reikalauja didelių energijos ir materialinių išteklių sąnaudų. E. coli dažnai naudojamas kaip reprezentatyvus mikroorganizmas tiriant naujus vandens valymo ir sterilizavimo metodus, įskaitant fotokatalizę. Taikant standartinius lėkštelių skaičiavimo metodus, po nuoseklaus praskiedimo ir auginimo agaro gelio plokštelėse, galima įvertinti gyvybingų organizmų arba CFU (kolonijas formuojančių vienetų) koncentraciją žinomame apdoroto vandens tūryje, kad būtų galima palyginti medžiagų eksploatacines savybes. [107]

    1946 m. ​​Joshua Lederbergas ir Edwardas Tatumas pirmą kartą aprašė reiškinį, žinomą kaip bakterinė konjugacija, naudojant E. coli kaip pavyzdinė bakterija [108] ir išlieka pagrindiniu konjugacijos tyrimo modeliu. [109] E. coli buvo neatsiejama pirmųjų eksperimentų, skirtų suprasti fagų genetiką, dalis [110], o ankstyvieji tyrinėtojai, tokie kaip Seymouras Benzeris, naudojo E. coli ir fagas T4, kad suprastų genų struktūros topografiją. [111] Iki Benzerio tyrimų nebuvo žinoma, ar genas yra linijinė struktūra, ar jis turi išsišakojimą. [112]

    E. coli buvo vienas pirmųjų organizmų, kurio genomas sekvenavo visą genomą E. coli K12 paskelbė Mokslas 1997 m. [55]

    2002–2010 metais Vengrijos mokslų akademijos komanda sukūrė padermę Escherichia coli vadinamas MDS42, kurį dabar parduoda Scarab Genomics of Madison, WI, pavadinimu "Clean Genome. E.coli", [113] kur 15 % tėvinės padermės (E. coli K-12 MG1655) genomo buvo. pašalinami, kad padidėtų molekulinės biologijos efektyvumas, pašalinami IS elementai, pseudogenai ir fagai, todėl geriau palaikomi plazmidėmis koduojami toksiški genai, kuriuos dažnai inaktyvuoja transpozonai. [114] [115] [116] Biochemija ir replikacijos mašinos nebuvo pakeistos.

    Įvertinus galimą nanotechnologijų derinį su kraštovaizdžio ekologija, galima sukurti sudėtingus buveinių kraštovaizdžius naudojant nanoskalės detales. [117] Tokiose sintetinėse ekosistemose evoliuciniai eksperimentai su E. coli buvo atlikti siekiant ištirti adaptacijos erdvinę biofiziką salos biogeografijos lustoje.

    Taip pat atliekami tyrimai, bandant programuoti E. coli išspręsti sudėtingas matematikos problemas, tokias kaip Hamiltono kelio uždavinys. [118]

    Kitų tyrimų metu nepatogeniškas E. coli buvo naudojamas kaip pavyzdinis mikroorganizmas, siekiant suprasti imituojamos mikrogravitacijos (Žemėje) poveikį tam pačiam. [119] [120]

    1885 metais vokiečių ir austrų pediatras Theodoras Escherichas atrado šį organizmą sveikų žmonių išmatose. Jis tai pavadino Bakterijų colių bendruomenė nes jis randamas dvitaškyje. Ankstyvosios prokariotų klasifikacijos suskirstė juos į keletą genčių pagal jų formą ir judrumą (tuo metu galiojo Ernsto Haeckelio Moneros karalystės bakterijų klasifikacija). [91] [121] [122]

    Bakterijos coli buvo dabar negaliojančios genties tipo rūšis Bakterija kai buvo atskleista, kad buvusio tipo rūšis ("Triloculare bakterija“) trūko. [123] Peržiūrėjus Bakterija, jis buvo perkvalifikuotas į Bacillus coli Migula 1895 m. [124] ir vėliau perklasifikuota į naujai sukurtą gentį Escherichia, pavadintas pirminio atradėjo vardu. [125]

    1996 m., iki šiol baisiausias pasaulyje protrūkis E. coli Vishave (Škotija) įvyko apsinuodijimas maistu, nusinešęs 21 žmogaus gyvybę. [126] Šis mirčių skaičius buvo viršytas 2011 m., kai 2011 m. Vokietijoje E. coli O104:H4 protrūkis, susijęs su ekologiškais ožragės daigais, nusinešė 53 žmonių gyvybes.


    Diskusija

    Šiame tyrime buvo sukonstruotos ir naudojamos BANA ir BARNA šviesos varomos sistemos, skirtos erdvėlaikiam reguliuoti ląstelių dalijimąsi. E. coli. Kai BANA šviesos energija varoma sistema buvo naudojama sutrumpinti ląstelių dalijimąsi E. coli DN4, SSA ir acetoino titras E. coli DN4 buvo padidintas iki 3,7 μm -1 ir 67,2 g L -1 , kurie buvo 20,39 ir 39,19% didesni nei E. coli D1, atitinkamai. Kai BARNA šviesos energija varoma sistema buvo naudojama pratęsti ląstelių dalijimąsi E. coli DQ8, MCV, PLH turinys, DCW ir PLH titras E. coli DQ8 buvo padidintas iki 52,6 μm 3, 53,8 masės%, 26,6 ir 14,31 g L –1, kurie buvo 13,65 karto, 2,01 karto, 1,18 karto ir 2,38 karto didesni nei E. coli DQ0, atitinkamai. Šie rezultatai parodė, kad ląstelių dalijimosi C ir D laikotarpių inžinerija buvo naudinga strategija siekiant supaprastinti mikrobų ląstelių gamyklų efektyvumą.

    Ląstelių dalijimasis Escherichia coli yra tarpininkaujama didelio baltymų komplekso ir dezoksiribonukleotidų 31,37, kuriuos reguliuoja du veiksniai: (i) teigiamas reguliatorius: nrdAB, nrdA, nrdB, ir nrdD genai ląstelių dalijimosi C periode katalizuoja dezoksiribonukleozido difosfatą dNTP gamybai, skatindami DNR replikaciją ląstelių dalijimuisi, o tada ftsZA, ftsZ, ftsA, ftsN, ir ftsQ Ląstelių dalijimosi D periodo genai susirenka į Z žiedo karkasą, kad paspartintų ląstelių dalijimąsi (ii) neigiamas reguliatorius: pašalinamas nrdAB, nrdA, nrdB, ir nrdD genai ląstelių dalijimosi C periode gali sutrikdyti dNTP sintezę, o tada sulA, minC, minD, minE, ir ftsH Ląstelių dalijimosi D periodo genai yra ląstelių dalijimosi inhibitoriai. Norint reguliuoti ląstelių dalijimąsi keliais lygiais, optogenetika yra daug žadanti strategija neinvaziniu, grįžtamu ir erdvėlaikiniu būdu 33 . Pavyzdžiui, mėlynos šviesos grįžtamojo ryšio geno grandinė buvo naudojama grįžtamai reguliuoti piruvato dekarboksilinimą, kad būtų atsietas ląstelių augimas ir cheminė gamyba, todėl izobutanolis ir 2-metil-1-butanolis pagamina iki 8,49 g L-1 ir 2,38 g L-1. atitinkamai 33 . Be to, raudona ir mėlyna šviesa buvo panaudota Bphs ir BlrP1 baltymams reguliuoti bioplėvelės formavimui44. Remiantis šiais tyrimais, buvo pasiūlyta optogenetika pagrįsta ląstelių dalijimosi strategija: optogenetinė strategija buvo naudojama sutrumpinti arba pailginti ląstelių dalijimosi C+D periodą, erdvėlaikiškai kontroliuojant genus, dalyvaujančius ląstelių dalijimosi C+D perioduose skirtingose ​​fazėse. su įvairiu šviesos intensyvumu ir laiku. Taip buvo sukonstruotos dvi skirtingos šviesos varomos sistemos – BANA ir BARNA. BARNA šviesos energija varoma sistema buvo naudojama silpnai ekspresijai nrdA ir per didelė raiška nrdAB, ftsZA, ir sulA in E. coli DQ8, taigi, C ir D ląstelių dalijimosi periodai buvo pailginti. Dėl to ši sistema sukelia mini ląstelių fenotipą 29 ir padidina ląstelių skaičių bei ląstelių augimą30,45. Siekiant užkirsti kelią DNR replikacijai ir sumažinti ląstelių dalijimosi dažnį, silpnai ekspresijai buvo naudojama BARNA šviesos energija varoma sistema. nrdA ir per didelė raiška nrdAB, ftsZA, ir sulA in E. coli DQ8, taigi, pailgėjo ląstelių dalijimosi C ir D periodai. Taigi ši sistema sukelia didelių ląstelių fenotipą ir sumažina ląstelių skaičių bei ląstelių augimą13,46.

    Kaip gyvybiškai svarbus pramoninių mikrobų 20, 47 fiziologinis parametras, SSA gali padidinti masės perdavimą, padidindamas maistinių medžiagų įsisavinimo greitį ir ląstelių augimą bei pagerindamas ląstelių tankį, pakeisdamas kultūrų reologiją. Pramoninės fermentacijos metu SSA gali paveikti mechaninis slėgis, terpės kiekis ir cheminis stresas 16 . Taigi, daugelis pastangų parodė jų taikymo galimybes reguliuojant SSA, pavyzdžiui, mikrodalelių auginimą 20 , fermentacijos optimizavimą 48 ir laboratorinę adaptyviąją evoliucijos inžineriją 49 . Remiantis šiomis strategijomis, cheminės gamybos efektyvumas bus padidintas padidinus pramoninių mikrobų SSA. Šiame tyrime, kai BANA sutrumpino C ir D ląstelių dalijimosi laikotarpius, SSA padidėjo 20,39%. Dėl to acetoino titras padidėjo 39,19%, palyginti su E. coli D1. Šie rezultatai parodė, kad acetoino gamyba pagerėjo tiksliai kontroliuojant ląstelių dalijimąsi ir inžinerinį SSA. Šis tyrimas skyrėsi nuo ankstesnių tyrimų, kuriuose buvo nustatyti tiksliniai metabolizmo būdai41 ir pašalintas anglies katabolitų slopinimas50.

    Pramoninių mikrobų MCV yra svarbus fiziologinis parametras51, kuriuo norime maksimaliai padidinti inkliuzinio kūno gamybą. Be to, reikėtų atsižvelgti į tai, kad MCV pagerina biologinio apdorojimo prieš srovę ir pasroviui efektyvumą greičiau nusodinant ląsteles su santykinai didesne gravitacija. Siekiant manipuliuoti pramoninių mikrobų MCV, buvo sukurta daugybė strategijų, tokių kaip peptidoglikano ląstelės sienelės sintezės trikdymas, siekiant gauti elastingesnę ir lankstesnę ląstelės struktūrą 24 , citoskeleto mutantų morfologinių savybių patikrinimas 25 ir fosfatidilinozitolio biosintezės in vivo sutrikimas. siūlinėms struktūroms formuotis 23 . Šiame tyrime, kai ląstelių dalijimosi C ir D periodai buvo pailginti naudojant BARNA šviesos energiją naudojančias sistemas, MCV E. coli DQ8 buvo parodytas 13,65 karto padidėjimas. Dėl to padidėjo ląstelių erdvė PLH kaupimuisi, taigi ir PLH kiekis E. coli DQ8 padidėjo 2,01 karto, palyginti su E. coli DQ0. Šie rezultatai parodė, kad PLH gamyba pagerėjo tiksliai reguliuojant ląstelių dalijimosi C ir D periodus, kad padidėtų MCV E. coli DQ8. Silpna išraiška nrdA gali pailginti ląstelių dalijimosi C laikotarpį, sutrikdydamas tarpląstelinę dNTP sintezę ir DNR replikaciją bei per didelę sulA gali pailginti ląstelių dalijimosi D laikotarpį, trukdydamas Z žiedo formavimuisi ir dalijimosi agregacijai 46 . Taigi, pailgėjęs ląstelių dalijimasis 29 paveiktų ląstelių dalijimosi dažnį, todėl padidėtų ląstelių dydis. Didesnė ląstelių erdvė PLH kaupimui pagerino PLH turinį, titrą ir DCW. Šio tyrimo strategija skyrėsi nuo ankstesnių strategijų, tokių kaip tikslinių medžiagų apykaitos takų projektavimas52, metabolinio potransliacinio keitimo panaudojimas53 ir kofaktoriaus santykio kontrolė54.

    Šiame tyrime buvo sukurta optogenetika pagrįsta ląstelių dalijimosi strategija, kuri yra neinvazinė ir apima erdvinę, laiko ir grįžtamąją kontrolę. SSA ir MCV E. coli buvo padidintos sutrumpinus arba pailginus ląstelių dalijimosi C ir D periodus, naudojant atitinkamai BANA arba BRANA šviesos energiją. Remiantis tuo, didesnės SSA arba MCV vertės padidino acetoino arba PLH gamybos efektyvumą. Mūsų rezultatai parodė, kad padidinus SSA ir MCV manipuliuojant ląstelių dalijimusi, gali padidėti tikslinė cheminė gamyba. Be to, ši optogenetine ląstelių dalijimosi strategija gali būti būdas statyti mikrobų ląstelių gamyklas didelės vertės cheminių medžiagų gamybai.


    E. Coli bakterijos: ateities energijos šaltinis?

    Daugumai žmonių pavadinimas „E. coli“ yra apsinuodijimo maistu ir produktų atšaukimo sinonimas, tačiau Teksaso A&M universiteto Chemijos inžinerijos katedros profesorius įsivaizduoja, kad bakterijos yra ateities energijos šaltinis, padedantis aprūpinti energija mūsų automobilius, namus ir kt.

    Genetiškai modifikuodamas bakterijas, Artie McFerrin chemijos inžinerijos katedros profesorius Thomas Woodas „pakeitė“ E. coli padermę taip, kad ji gamintų didelius vandenilio kiekius. Konkrečiai, Woodo padermė gamina 140 kartų daugiau vandenilio, nei susidaro natūraliai vykstančio proceso metu, rašoma straipsnyje „Mikrobinė biotechnologija“, kuriame išsamiai aprašomi jo tyrimai.

    Nors Woodas pripažįsta, kad dar reikia daug nuveikti, kol jo tyrimai taps bet kokiais komerciniais tikslais, jo pradinė sėkmė gali tapti svarbiu laipteliu kelyje į vandenilio ekonomiką, kuri, daugelio nuomone, yra šios šalies ateities.

    Atsinaujinantis, švarus ir efektyvus vandenilis yra pagrindinė kuro elementų technologijos sudedamoji dalis, kuri gali aprūpinti viską nuo nešiojamos elektronikos iki automobilių ir net ištisų elektrinių. Šiandien didžioji dalis pasaulyje gaminamo vandenilio susidaro vykstant procesui, vadinamam „krekingo vandeniu“, kurio metu vandenilis atskiriamas nuo deguonies. Tačiau procesas yra brangus ir reikalauja daug energijos – viena iš pagrindinių priežasčių, kodėl ši technologija dar neprigijo.

    Wood darbas su E. coli gali tai pakeisti.

    Nors visuomenė gali būti įpratusi girdėti apie labai specifinę padermę, kuri gali sukelti apsinuodijimą maistu, dauguma padermių yra įprastos ir nekenksmingos, netgi padeda jų šeimininkams, neleisdamos kitoms kenksmingoms bakterijoms įsitvirtinti žmogaus žarnyno trakte.

    O E. coli panaudojimas moksle nėra jokia naujiena, ji buvo naudojama žmogaus insulino gamyboje ir vakcinų kūrime.

    Bet kaip potencialus energijos šaltinis?

    Tai nauja teritorija, kurios pradininkas yra Woodas ir jo kolegos.

    Selektyviai ištrindamas šešis specifinius E. coli DNR genus, Vudas iš esmės pavertė bakteriją į mini vandenilio gamybos gamyklą, kuri maitinama cukrumi. Kalbant moksliškai, mediena didžiuliu mastu sustiprino natūraliai bakterijų vykstantį gliukozės konversijos procesą.

    „Šios bakterijos turi 5000 genų, leidžiančių joms išgyventi aplinkos pokyčius“, – paaiškino Wood. "Kai viską išmušame, bakterijos tampa mažiau konkurencingos. Mes nesuteikėme joms galimybių ką nors padaryti. Jos čia nieko neįgyja, jos praranda. Mūsų gaminamos bakterijos yra mažiau konkurencingos ir mažiau kenksmingos, nes kas buvo pašalinta“.

    Su cukrumi kaip pagrindiniu energijos šaltiniu, ši E. coli atmaina dabar gali pasinaudoti esamais ir nuolat besiplečiančiais moksliniais procesais, kuriais siekiama gaminti cukrų iš tam tikrų kultūrų, pavyzdžiui, kukurūzų, sakė Wood.

    „Daugelis žmonių stengiasi paversti tai, ką išauginate, į cukrų“, – paaiškino Wood. "Mes norime paimti tą cukrų ir paversti jį vandeniliu. Mes iš kažkur gausime cukrų iš kažkokių pasėlių. Gausime tam tikros formos į cukrų panašią molekulę ir panaudosime bakterijas, kad ją paverstume vandeniliu."

    Biologiniai metodai, tokie kaip šis (E. coli gamina vandenilį fermentacijos proceso metu), greičiausiai sumažins energijos sąnaudas, nes šiems procesams nereikia didelio šildymo ar elektros energijos“, - sakė Wood.

    „Vienas iš sudėtingiausių dalykų, susijusių su chemijos inžinerija, yra tai, kaip jūs gaunate produktą“, - paaiškino Wood. "Šiuo atveju tai labai paprasta, nes vandenilis yra dujos, ir jis tiesiog burbuliuoja iš tirpalo. Jūs tiesiog pagaunate dujas, kai jos išeina iš stiklo. Tai viskas. Turite gryną vandenilį."

    Taip pat yra ir kitų privalumų.

    Kaip ir galima tikėtis, visiškai naujo vandeniliui transportuoti skirto dujotiekio tiesimo kaina labai atgraso nuo vandenilio kuro elementų technologijos panaudojimo. Be to, gabenant vandenilį taip pat padidėja rizika.

    Wood mano, kad sprendimas yra vandenilio pavertimas vietoje.

    „Pagrindinis dalykas, mūsų manymu, yra tai, kad galite gabenti tokius daiktus kaip cukrus, o jei cukrų išsiliesite, tai neįvyks didžiulė katastrofa“, – sakė Woodas. „Idėja yra gaminti vandenilį ten, kur jo reikia“.

    Žinoma, visa tai yra pakeliui.Šiuo metu Wood vis dar užsiėmęs laboratorijoje, tobulindamas procesą, kuris jau užsimena apie neįtikėtiną potencialą. Jo teigimu, tikslas yra ir toliau gauti daugiau iš mažiau.

    „Paimkite, pavyzdžiui, savo namą“, – pasakė Wood. "Reaktoriaus dydis, kurio mums šiandien prireiktų, jei įdiegtume šią technologiją, būtų mažesnis nei 250 galonų kuro bakas, esantis tipiškuose rytinės pakrantės namuose. Dar nebaigiau, bet Šiuo atveju, jei technologiją įdiegtume dabar, jūs arba mašina kiekvieną dieną turėtumėt kastuvu įpilti maždaug žmogaus svorio, kad reaktorius galėtų tiekti pakankamai vandenilio, kad 24 valandas būtų galima pasirūpinti vidutiniais Amerikos namais.

    „Stengiamės sukurti bakterijas, kad nereikėtų 80 kilogramų, o bus arčiau 8 kilogramų.

    Istorijos šaltinis:

    Pateiktos medžiagos Teksaso A&M universitetas. Pastaba: turinys gali būti redaguojamas pagal stilių ir ilgį.


    Medžiagos ir metodai

    Padermės ir terpė

    Jei nenurodyta kitaip, genetinėms grandinėms apibūdinti naudojama padermė E. coli MG1655 (numeracija pagrįsta genomo seka, NCBI U00096.3 Blattner ir kt, 1997). Plazmidžių inžinerija buvo atlikta naudojant E. coli DH10β (New England Biolabs, JAV, C3019H) arba E. coli DH5α (New England Biolabs, JAV, C2988J). E. coli TransforMax™ EC100D™ pir + (Lucigen, JAV, CP09500)) ir E. coli JTK164A (Kittleson ir kt, 2011), buvo naudojami plazmidėms, turinčioms R6K replikacijos pradžią. Dėl konjugacijos, E. coli S17-1 λpir padermė (TpR, SmR, recA, tai, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir) buvo naudojamas kaip donorinis štamas, kad būtų pristatytos plazmidės su R6K replikacijos pradžia ir OriT. LB terpė (BD Biosciences, JAV, BD244610) buvo naudojama ląstelių augimui ir klonavimui. 2xYT terpė (BD Biosciences, JAV, DF0440-17) buvo naudojama ląstelėms auginti plazmidėms ekstrahuoti naudojant QIAprep Spin Miniprep rinkinį (Qiagen, JAV, 27104). Elektrokompetentingos ląstelės buvo paruoštos SOB terpėje (Teknova, JAV, S0210). SOC atkūrimo terpė (New England Biolabs, JAV, B9020S) buvo naudojamos ląstelėms atkurti po transformacijos. M9 terpę sudaro M9 minimali druska (Sigma-Aldrich, JAV, M6030), papildyta 0,034% tiamino (Fisher Scientific, JAV, BP892-100), 0,4% gliukozės (Fisher Chemical, JAV, M-10046U) ir 0,2% kazaminorūgšties. (BD Biosciences, JAV, 223050). Ši laikmena (toliau vadinama „M9 laikmena“) buvo naudojama visiems matavimams ir apibūdinimams, jei nenurodyta kitaip. Naudojami šie antibiotikai: ampicilinas (100 μg/ml, Amp) (GoldBio, JAV, A-301-5), chloramfenikolis (34 μg/ml, Cm) (Alfa Aesar, JAV, AAB20841-14), kanamicinas (50). μg/ml, Kan) (GoldBio, JAV, K-120-10), spektinomicinas (40 μg/mL, Sp) (MP Biomedicals LLC, JAV, 158993) ir tetraciklinas (5 μg/ml, Tet) (GoldBio, JAV, T-101-25). Visi oligonukleotidai, Gblokai ir oligos buvo užsakyti iš IDT (Integrated DNA Technologies, JAV priedo S14 pav. ir priedo lentelės S4–S8).

    Terminatoriaus identifikavimas iš genomo sekų

    Kandidatai į terminatorius buvo nustatyti iš E. coli MG1655 genomas (NCBI RefSeq: NC_000913), naudojant RNIE 0.01 versiją su numatytaisiais nustatymais ir „genome.cm“ terminatoriaus modeliu („Gardner“) ir kt, 2011). Taip buvo sukurtas išvesties GFF failas, kuriame yra vieta (pradžios ir pabaigos bazinė pora), orientacija (prasminė arba antisensinė kryptis) ir kiekvienos tariamos terminatoriaus dalies balų statistika. Norint įvertinti kiekvieno tariamo terminatoriaus stiprumą, iš neapdorotų RNR-seq skaitymų buvo sukurti tiek sensorinių, tiek antisensinių MG1655 genomo grandžių transkripcijos profiliai (Gorochowski). ir kt, 2017). Tada kiekvienam numanomam terminatoriui buvo parinktas atitinkamas prasmės arba antisensinės grandinės transkripcijos profilis (atsižvelgiant į terminatoriaus orientaciją). Tada terminatoriaus stiprumas buvo įvertintas išmatuojant vidutinį transkripcijos profilio aukštį 25 bp srityje prieš ir po terminatoriaus padėties (siekiant išlyginti lokalizuotus svyravimus) ir apskaičiuojant vidutinio transkripcijos profilio aukščio santykį iškart po terminatoriaus ir tiesiai prieš . Galiausiai, tie terminatoriai, kurie anksčiau buvo naudojami kituose darbuose (Chen ir kt, 2013) buvo išfiltruoti ir sudarytas galutinis terminatorių sąrašas pagal užbaigimo stiprumą.

    Terminatoriaus stiprumo matavimas

    Terminatoriai buvo apibūdinti po anksčiau paskelbto tyrimo (Chen ir kt, 2013). Jie buvo klonuoti į pGR plazmidę (Priedo S14 pav., Priedo S1 pav., Priedo S1 ir S5 lentelės). Escherichia coli DH5α, turinčios pGR plazmides su terminatoriumi (pGR-DT#), buvo kultivuojamos per naktį 200 μl LB terpės su ampicilinu (100 μg/ml). Ląstelės buvo kultivuojamos naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662) ELMI Digital Thermo Microplate Shaker inkubatoriuje (ELMI Ltd, Latvija, toliau – ELMI plokštelių purtyklė). Kitą dieną ląstelės buvo 200 kartų praskiestos 200 μl šviežios LB terpės su ampicilinu (100 μg/ml) ir 12,5 mM L-arabinoze (Sigma-Aldrich, JAV, A3256). Ląstelės buvo indukuotos 3 valandas 37 ° C temperatūroje ir 1000 aps./min. ELMI plokštelių purtyklėje. Po indukcijos fluorescencijos lygiai buvo analizuojami naudojant srauto citometriją, o GFP (FITC-A) ir RFP (PE-Texas-RED-A) geometrinis vidurkis buvo apskaičiuotas naudojant FlowJo (TreeStar, Inc., JAV) programinę įrangą. Tada šie geometriniai vidurkiai buvo naudojami terminatoriaus stiprumui apskaičiuoti, TS = [(<GFP>terminas/<RFP>terminas)/(<GFP>ref/<RFP>ref)]. <RFP>terminas ir <GFP>terminas reiškia geometrinį vidurkį, apskaičiuotą ląstelėms, kuriose yra plazmidės terminatorius, atėmus autofluorescenciją. <RFP>ref ir <GFP>ref reiškia geometrinį vidurkį, apskaičiuotą naudojant pGR plazmidę be terminatoriaus tarp GFP ir RFP, atėmus autofluorescenciją.

    Srauto citometrijos analizė

    Citometrija buvo atlikta naudojant LSRII Fortessa srauto citometrą (BD Biosciences, JAV). Nuėmus derlių, ląstelės buvo praskiestos 200 μl 1 × PBS ([NaCl]: 137 mM, [KCl]: 2,7 mM, [Na2HPO4]: 10 mM ir [KH2PO4]: 1,8 mM) su 2 mg/ml kanamicino. Naudota 437 V FSC įtampa, 289 V SSC, 425 V žaliojo lazerio (488 nm) ir 489 V raudonojo lazerio (561 nm) įtampa. Kiekvienam mėginiui buvo užregistruota > 30 000 įvykių. Užregistruoti srauto citometrijos duomenys buvo toliau analizuojami naudojant programinę įrangą FlowJo. FITC-A ir PE-Texas Red-A medianos reikšmės buvo naudojamos išraiškos lygio pasiskirstymui populiacijoje parodyti.

    Tn5 transpozonų bibliotekos statyba

    plYJP017 plazmidė, kurioje yra konstituciškai išreikštas mCherry zondas, buvo sukurta modifikuojant pBAMD1-4 plazmidę (Martinez-Garcia ir kt, 2014). Siekiant užkirsti kelią nuolatiniam tnpA išraiška iš pagrindinės integracijos, sfGFP buvo pridėtas prie pagrindo kaip priešinio pasirinkimo žymeklis (1b pav.). Escherichia coli S17-1 λpir elektrokompetentinės ląstelės buvo transformuotos plYJP017 plazmide. Tada kamienas, turintis plYJP017 plazmidę, buvo naudojamas konjugacijai su E. coli DH10β, turintis atsparumo tetraciklinui (Tet) žymeklį (tetA) genome (YJP_DHC404 priedas S14 pav.). Donorinės padermės (E. coli S17-1 λpir) ir recipientinės padermės (E. coli DH10β) buvo atskirai auginami per naktį 200 μl LB terpėje su antibiotikais 37 ° C temperatūroje ir 1000 aps./min. naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662) ELMI plokštelių purtykloje. Kitą dieną ląstelės buvo 200 kartų praskiestos į 4 ml LB terpės su antibiotikais ir inkubuojamos 2,5 valandos 37 °C temperatūroje 250 aps./min. New Brunswick Innova 44 Shaker (Eppendorfas, JAV). Kai ląstelės pasiekia OD600 = 0,4, buvo sumaišyta 250 μl tiek donoro, tiek recipiento ląstelių. Tada ląstelės buvo švelniai centrifuguojamos (8000 g, 25°C) ir keturis kartus kambario temperatūroje plaunama 1 ml LB be antibiotikų. Galiausiai ląstelių granulės buvo resuspenduotos su 50 μl SOC regeneravimo terpės ir buvo pastebėtos ant paprastos LB agaro plokštelės (7 μl vienoje vietoje). Dėmėtosios LB agaro plokštelės buvo inkubuojamos 5 valandas 37 ° C temperatūroje. Tada ląstelės buvo surinktos ir resuspenduojamos į 1 ml SOC regeneravimo terpę, po to iškart du papildomi praskiedimai (100 ir 10 000 kartų). Tada 75 μl kiekvienos praskiestos ląstelių suspensijos buvo dedamos ant LB agaro plokštelių su spektinomicinu (40 μg/ml) ir tetraciklinu (5 μg/ml). Kitą dieną pavienės kolonijos buvo paimtos iš plokštelių ir auginamos 200 μl M9 terpėje 5,5 valandos 37 °C temperatūroje ir 1000 aps./min. ELMI plokštelių purtyklėje, naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662). Po inkubacijos ląstelės buvo analizuojamos srauto citometrija, matuojant GFP (FITC-A) ir mCherry (PE-Texas RED) ekspresijos lygius. Tik ląstelės, turinčios mCherry, bet ne GFP, buvo naudojamos tolesnei analizei, siekiant nustatyti įterpimo vietą. Kiekvienos kolonijos įterpimo vieta buvo nustatyta amplifikuojant jungtį tarp įterptos DNR ir kaimyninės genomo DNR. Atsitiktinės atrankos pradmenys (oYJP1741: GGCACGCGTCGACTAGTACNNNNNNNNNNACGCC) ir įterpimui būdingas pradmuo (oYJP1745: CTTGGCCTCGCGCGCAGATCAG Martinez-Garcia ir kt, 2014), buvo naudojami jungties stiprinimui naudojant du iš eilės einančius PGR amplifikacijos ciklus. Kiekviena kolonija buvo suspenduota vandenyje ir 10 minučių inkubuojama 95 ° C temperatūroje, kad ląstelės visiškai lizuotų. 1,25 μl kolonijos suspensijos alikvotinė dalis buvo pridėta kaip PGR šablonas į PGR premiksą, kuriame yra 12,5 μl 2× Phusion High-Fidelity Master Mix (New England Biolabs, JAV, M0531), 10 μl vandens, 1,25 μl μM oYJP1741 pradmenų ir 0,5 μl 10 μM oYJP1745 pradmenų. Tada PGR produktai buvo suskirstyti pagal Sangerį naudojant vidinį pradmenį oYJP1746 (CACCAAGGTAGTCGGCAAAT) ir sulygiuoti naudojant NCBI nukleotidų sprogdinimą. Tolesniam apibūdinimui buvo pasirinkti tik įterpimai su unikaliu smūgiu. Kiekvienam Tn5 transpozonų bibliotekos nariui buvo apibūdinti mCherry ekspresijos lygiai ir augimo fenotipai. Kiekvienas klonas buvo išbrauktas ant LB agaro plokštelių su spektinomicinu (40 μg/ml) ir Tet (5 μg/ml). Pavienės kolonijos buvo paimtos iš plokštelių ir per naktį buvo pasėtos M9 terpėje be antibiotikų 16 valandų 37 ° C temperatūroje ir 1000 aps./min. ELMI plokštelių purtyklėje, naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662). Ląstelės buvo atskiestos 185 kartus į 200 μl šviežios M9 terpės ir inkubuojamos 3 valandas. Ląstelės vėl praskiestos 700 kartų į 200 μl šviežios M9 terpės ir auginamos 6 valandas. Po 6 valandų inkubavimo 30 μl ląstelių buvo pridėta į 200 μl 1 × PBS tirpalo su 2 mg/ml kanamicino (Kan) ir fluorescencija išmatuota naudojant srauto citometriją. Buvo išmatuotas kultūrų optinis tankis (OD) esant 600 nm. Norėdami tai padaryti, 150 μl kultūros buvo perkelta į optiškai skaidrias Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 165305). Galutinei kultūros absorbcijai matuoti buvo naudojamas hibridinis mikroplokštelių skaitytuvas BioTek Synergy H1 (BioTek Instruments Inc, JAV). Santykinis kiekvieno bibliotekos nario augimas buvo apskaičiuotas pagal santykinį augimą = ((OD600: Tn5) − (OD600: tuščia))/(OD600: DH10β Tet) − (OD600: tuščia)), kur OD600: Tn5, OD600: tuščia ir OD600: DH10β Tet kreiptis į OD600 Tn5 bibliotekos nario, tuščios M9 laikmenos ir E. coli DH10β su tetraciklino žymekliu genome, atitinkamai.

    Skaičiuojama numanomų ne tikslinių integrazės svetainių paieška

    Norint nustatyti galimas 2, 5 ir 7 integrazės netikslines svetaines, paskelbtos B/P svetainės (Yang ir kt, 2014 ) (priedo lentelės S5 ir S6) buvo ieškoma E. coli MG1655 genomas (NCBI U00096.3), naudojant megablastą (Zhang ir kt, 2000) ir blastn (Altschul ir kt, 1997). Kiekviena svetainė buvo patikrinta, ar ji (i) turi atitikties genomui per megablastą, (ii) apima > 30% užklausos sekos per blastn ir (iii) atitinka reikšmingą sutapimą (E vertė < 0,1). Jei kuris nors iš šių kriterijų buvo teisingas, svetainė buvo atmesta.

    Genominių nusileidimo aikštelių konstrukcija

    Nusileidimo kilimėliams įterpti į genomą buvo naudojami du metodai. Dvi tūpimo trinkelės (Nr. 1 ir Nr. 2) buvo įvestos paeiliui naudojant λ-RED rekombinavimą (Datsenko ir Wanner, 2000). E. coli MG1655 ląstelės, turinčios arabinozės indukuojamą λ-RED rekombinazę temperatūrai jautrios kilmės plazmidėje (pKD46 Datsenko ir Wanner, 2000), buvo auginamos per naktį naudojant Falcon 14 ml apvaliadugnius polipropileno mėgintuvėlius (Corning, JAV, 352). Ląstelės buvo auginamos 4 ml LB su Amp (100 μg / ml) 30 ° C temperatūroje ir 250 aps./min. New Brunswick Innova 44 Shaker (Eppendorf, JAV). Kitą dieną ląstelės buvo 200 kartų praskiestos 25 ml šviežios SOB terpės Erlenmejerio kolboje su įpjovomis dugnu su ampicilinu (100 μg/ml) ir 10 mM L-arabinoze. Ląstelės buvo indukuojamos tris valandas 30 °C temperatūroje ir 250 aps./min. New Brunswick Innova 44 Shaker (Eppendorfas, JAV), kol pasiekė OD.600 = 0,4. Tada ląstelės buvo centrifuguojamos (4700 g, 4°C, 10 min.), naudojant Legend XFR centrifugą (Thermo Scientific, JAV). Tada ląstelių granulės buvo plaunamos 5 ml atšaldyto 10% glicerolio ir vėl nusukamos iki 4700 g ir 4°C 10 min. Plovimo etapas buvo pakartotas dar du kartus, naudojant 1 ml atšaldyto 10% glicerolio, o ląstelės buvo susmulkintos naudojant šaldytuvo centrifugą (Eppendorf, JAV) esant 21 000 g ir 4°C 30 s. Galiausiai ląstelių granulės buvo resuspenduotos 500 μl atšaldyto 10% glicerolio. Tada 200 μl šių elektrokompetentingų ląstelių buvo transformuota 150 ng nusileidimo padėklo DNR naudojant elektroporaciją (2500 mA) (Eppendorf, JAV) ir išgauta pridedant 1 ml SOC regeneravimo terpės ir inkubuojama 30 °C temperatūroje 3 valandas. Tada transformuotos ląstelės buvo padengtos ant LB agaro (2%) su Cm (35 μg / ml) arba Kan (50 μg / ml) antibiotikais ir inkubuojamos 30 ° C temperatūroje per naktį. Nusileidimo trinkelių integravimas buvo patvirtintas PGR amplifikacija ir genominių regionų, kuriuose yra nusileidimo trinkelių, seka. 1 nusileidimo aikštelei buvo naudojami amplifikaciniai pradmenys oYJP3436 (CCTGATCAGGTTCCGCGGATCCCGAATAAACGGTC) ir oYJP3437 (AGGCGCTGGAAGCGCGCTTTGTGCTGGAAGATAAG). 2 nusileidimo kilimėliui buvo naudojami amplifikaciniai pradmenys oYJP3525 (ACCAATTGGCGCGCGCTTCGCAATAAAATTCCCTTCG) ir oYJP3526 (TGCCAAAGGCGATAGGTGAAATAATGTCGGCGACAGCGG). Integravus šias dvi tūpimo trinkeles, temperatūrai jautri plazmidė, turinti λ-RED rekombinazę, buvo pašalinta auginant ląsteles per naktį 37 ° C temperatūroje LB be Amp (100 μg / ml). Sėkmingai integravus 1 ir 2 nusileidimo aikšteles, buvo sukonstruota ir integruota 3 tūpimo aikštelė naudojant konkrečiai vietai pritaikytą mini-Tn7 transpoziciją (Choi & Schweizer, 2006). Pirma, nusileidimo padėklas Nr. 3 buvo klonuotas į plazmidę plYJP072 (Priedo S14 pav.). Kitas, E. coli S17-1 λpir elektrokompetentinės ląstelės buvo transformuotos su plYJP072, o gauta padermė buvo konjuguota su dviem skirtingais štamais, kad būtų galima poruotis. Šios dvi padermės susideda iš padermės, turinčios Tn7 transpozazę koduojančias plazmides, ir padermės, turinčios nusileidimo padėklus #1 ir #2 (aprašytas aukščiau). Konjuguotos ląstelės buvo padengtos LB agaro plokštele (2%) su Cm (35 μg/ml) arba Kan (50 μg/ml) ir Tet (5 μg/ml) antibiotikais. 3 nusileidimo kilimėlio įterpimas buvo patvirtintas PCR amplifikuojančiomis ir sekvenuojančiomis genominėmis sritimis, apimančiomis nusileidimo kilimėlį, naudojant PGR pradmenis oYJP2826 (AGAGATGACAGAAAAAATTTTTCATTCTGTGACAGAGAAAAAAGTAGCCGAAGATG) ir oYJP2827 (CCGCGTAAACGTTGGCGTAAACGTTGGCGTAAACG). Įdėjus nusileidimo kilimėlius, fagų transdukcija buvo naudojama, kad jos būtų perkeltos į švarų genominį foną. Transdukcija naudojant P1 fagą buvo vykdoma pagal anksčiau paskelbtą protokolą, jei nenurodyta kitaip (Thomason ir kt, 2007). Norėdami paruošti P1 lizatą, E. coli MG1655 ląstelės, turinčios nusileidimo padėklus su trimis antibiotikų žymenimis (Kan, Cm ir Tet) (YJP_MKC172), buvo kultivuojamos per naktį 37 ° C temperatūroje LB terpėje su antibiotikais. Kitą dieną ląstelės buvo 100 kartų praskiestos 5 ml LB, papildyto 0,2% gliukozės ir 5 mM kalcio chlorido (CaCl).2) be antibiotikų. Po 45 minučių inkubacijos 37 °C temperatūroje, 250 aps./min. New Brunswick Innova 44 Shaker (Eppendorfas, JAV), 100 μl P1 fago atsargų buvo paimta iš E. coli MG1655 buvo pridėta prie kultūros ir inkubuojama 3 valandas 37 ° C temperatūroje. Kai kultūra buvo išvalyta, įlašinami keli lašai chloroformo (CHCl3) buvo pridėtos. Ląstelių nuolaužos buvo nusuktos iki 9200 g 10 min. 4 °C temperatūroje, naudojant šaldytuvo centrifugą (Eppendorf, JAV). Gautas P1 lizatas buvo toliau gryninamas per 0, 45 μm švirkšto filtrą (VWR international USA, 28145-481). Norėdami atlikti P1 transdukciją, laukinio tipo E. coli MG1655 buvo auginamas LB per naktį 37 ° C temperatūroje iš vienos kolonijos. Kitą dieną buvo surinkta 1,5 ml vienos nakties kultūros ir resuspenduojama 0,75 ml P1 druskos tirpalo (10 mM CaCl).2 ir 5 mM MgSO4) („Fisher Scientific“, JAV). Į 100 μl pakartotinai suspenduotų ląstelių buvo įpilami įvairūs P1 lizato tūriai (100, 10 ir 1 μl) ir inkubuojami 30 minučių 25 ° C temperatūroje. Mišiniai buvo perkelti į 1 ml LB, papildytą 200 μl natrio citrato, ir 1 valandą inkubuojami 37 ° C temperatūroje ir 250 aps./min. New Brunswick Innova 44 Shaker (Eppendorf, JAV). Po inkubacijos ląstelės buvo centrifuguojamos esant 21 000 g ir 25 °C temperatūroje 30 sekundžių ir buvo dedamos ant LB agaro (2%) plokštelių su antibiotikais ir 5 mM natrio citratu. Kolonijos buvo patikrintos naudojant PGR amplifikuojančią genominę DNR su pradmenimis, kaip aprašyta aukščiau (oYJP3436 ir oYJP3437, skirtas nusileidimo aikštelei Nr. 1, oYJP3525 ir oYJP3526 nusileidimo aikštelei Nr. 2 ir oYJP2826 ir oYJP282 #3). Po genominio tūpimo trinkelių įterpimo kiekvienoje tūpimo aikštelėje buvo unikalus atsparumo antibiotikams žymeklis (atitinkamai Cm, Kan ir Tet, skirti nusileidimo trinkelėmis Nr. 1, Nr. 2 ir Nr. 3). Šie atsparumo antibiotikams žymenys buvo tarp poros vienakrypčių flipazės atpažinimo taikinių (FRT) vietų.

    RNR sek

    RNR-seq bibliotekos buvo paruoštos pagal anksčiau aprašytą metodą (Gorochowski ir kt, 2017 ). Escherichia coli MG1655 padermės su integruotomis tūpimo trinkelėmis (YJP_MKC173) pirmą kartą buvo padengtos LB agaro (2%) plokštelėmis be antibiotikų ir inkubuojamos 37 ° C temperatūroje. Atrinktos pavienės kolonijos ir per naktį auginamos M9 terpėje be antibiotikų 37 ° C temperatūroje. Kitą dieną ląstelės buvo atskiestos 185 kartus į 200 μl M9 terpės be antibiotikų ir auginamos 3 valandas 37 °C temperatūroje ir 1000 aps./min. ELMI plokštelių purtyklėje naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662). Po 3 valandų ląstelės buvo atskiestos 700 kartų, pridedant 4,28 μl kultūros į 3 ml M9 terpės be antibiotikų.Ląstelės buvo auginamos naudojant Falcon 14 ml apvaliadugnius polipropileninius mėgintuvėlius (Corning, JAV, 352059) Innova 44 Shaker (Eppendorf, JAV) 37 °C temperatūroje, 250 aps./min. Po 5 valandų ląstelės buvo nusuktos 4 ° C ir 21 000 laipsnių temperatūroje g 3 minutes, kad surinktumėte ląstelių granules RNR-seq bibliotekos paruošimui. Išmetus supernatantus, ląstelių granulės buvo greitai užšaldytos skystame azote, kad būtų galima laikyti -80 ° C temperatūroje. Ląstelių granulės buvo lizuojamos pridedant 1 mg lizocimo, 10 mM Tris-HCl (pH 8,0) su 0,1 mM EDTA, o visa RNR buvo ekstrahuota naudojant PureLink RNA Mini Kit (Life Technologies, CA, 12183020). RNR mėginiai buvo toliau gryninami ir koncentruojami naudojant RNA Clean & Concentrator-5 Kit (Zymo Research, R1015), kurį patikrino Bioanalyzer (Agilent, CA). Ribosominės RNR buvo išeikvotos iš RNR mėginių, naudojant Ribo-Zero rRNR pašalinimo rinkinį bakterijoms (Illumina, CA, MRZMB126). Kiekvienam mėginiui buvo gauti RNR vientisumo skaičiai (RIN), o bibliotekos paruošimui buvo atrinkti tik tie mėginiai, kurių RIN > 8,5. Konkrečios sruogos RNAtag-seq bibliotekos buvo sukurtos Broad Technology Labs Microbial Omics Core (MOC), kur unikaliai brūkšniniu kodu pažymėti mėginiai buvo sujungti į dvi atskiras Illumina HiSeq 2500 juostas. Po sekos nustatymo, abiejų juostų rodmenys buvo sujungti. , o sujungtas mišinys buvo demultipleksuotas į originalius mėginius, po to nukirpta brūkšninio kodo žyma iš kiekvieno skaitymo. Lizocimas, Tris-HCl (pH 8,0) ir EDTA, kurie buvo naudojami RNR-seq bibliotekos paruošimui, buvo įsigyti atitinkamai iš Sigma-Aldrich (L6871), USB (75825) ir USB (15694). Neapdoroti sekos skaitymai buvo suderinti su etaloniniais genomais, o transkripcijos profiliai buvo sukurti pagal anksčiau sukurtą vidinį Python scenarijų (Gorochowski ir kt, 2017). Trumpai tariant, pirmasis proceso žingsnis buvo sukurti naujus etaloninius failus padermių genomui su integruotomis tūpimo trinkelėmis. Todėl kiekvienai padermei visos integruotos DNR sekos buvo įterptos į atitinkamas vietas etaloniniame genome E. coli MG1655 (NCBI RefSeq: NC_000913.3). Tada šie nauji FASTA ir GFF failai buvo naudojami neapdorotiems skaitymams suderinti naudojant BWA 0.7.4 versiją su numatytaisiais nustatymais, todėl buvo gauti atitinkami SAM ir BAM failai. Tada BAM failai buvo filtruojami naudojant SAMtools komandą „view“ (Li ir kt, 2009 Barnett ir kt, 2011), o filtrų kodai 83 ir 163 buvo pritaikyti norint pasirinkti skaitymo susiejimą su jutimo grandine, o filtrų kodai 99 ir 147 buvo pritaikyti atrinkti skaitymo atvaizdavimą antprasminėms grandinėms. Galiausiai, filtruotas skaitymo aprėptis kiekvienoje etaloninės sekos pozicijoje buvo normalizuotas pagal bendrą susietų nukleotidų skaičių visame genome ir padaugintas iš 109, kad būtų generuojami transkripcijos profiliai tiek pirmyn, tiek atgal per visą genomą.

    Nuo tiamino priklausomo augimo įvertinimas

    Escherichia coli MG1655 ir dvi padermės, turinčios Landing Pad #1 v1 ir v2, buvo auginamos M9 terpėje (su tiaminu) per naktį. Kitą dieną visos trys kultūros buvo centrifuguotos (15 000 g, 25 °C, 3 min.) ir tris kartus resuspenduojamas į DI vandenį, kad pašalintų terpėje esantį tiamino likutį. OD600 buvo išmatuotas resuspenduotų ląstelių kiekis ir ląstelės buvo praskiestos iki OD600 = 0,01. Tada kiekvienas skiedimas buvo pasėtas į M9 terpę be tiamino, kurią sudaro M9 minimali druska (Sigma-Aldrich, JAV, M6030), papildyta 0, 4% gliukozės ir 0, 2% kazamino rūgštimis (BD Biosciences, JAV, 223050). Po 6 valandų inkubavimo 37 °C temperatūroje ir 250 aps./min. New Brunswick Innova 44 Shaker (Eppendorfas, JAV), OD600 trijų mėginių ir tuščiojo mėginio, kuriame buvo tik M9 terpės be tiamino, kiekis buvo išmatuotas naudojant Cary 50 Bio spektrofotometrą (Agilent, JAV).

    Naudingųjų krovinių įdėjimas į nusileidimo aikšteles

    Atkreipkite dėmesį, kad paprastas detalus protokolas pateikiamas kaip priedo pastaba S1. Padermė, kurioje yra tuščios tūpimo pagalvės, buvo kartu transformuota su plazmide, koduojančia tris integrazes (plYJP053), ir plazmide, turinčia DNR naudingąsias apkrovas (plYJP066-KanR, plYJP070-CmR ir plYJP064-TetR). Norint paruošti elektrokompetentingas ląsteles, viena kolonija buvo inokuliuota į 2 ml LB be antibiotikų ir auginama 12 valandų 37 °C temperatūroje ir 250 aps./min. New Brunswick Innova 44 Shaker (Eppendorfas, JAV), naudojant Falcon 14 ml apvaliadugnius polipropileno mėgintuvėlius. (Corning, JAV, 352059). Kitą dieną 125 μl vienos nakties kultūros buvo įpilta į 25 ml SOB terpės Erlenmejerio kolboje su įpjovomis. Ląstelės buvo auginamos 2 valandas 37 ° C temperatūroje ir 250 aps./min. New Brunswick Innova 44 Shaker (Eppendorf, JAV). Kai buvo pasiekta ankstyvoji eksponentinė fazė (OD600 = 0,3–0,5), ląstelės buvo centrifuguotos (4700 g, 4°C, 10 min) ir tris kartus išplautas atšaldytu 10 % gliceroliu. Po trečio plovimo ląstelės buvo resuspenduojamos 200 μl atšaldyto 10% glicerolio. Ląstelės buvo elektroporuotos su 500 ng plYJP053 plazmidės ir 500 ng naudingosios apkrovos plazmidžių. Iš karto po transformacijos į ląsteles buvo pridėta 1 ml SOC regeneravimo terpės. Tada ląstelės buvo inkubuojamos 30 ° C temperatūroje 3 valandas ir dedamos ant LB agaro plokštelių (2%) su reikalingais antibiotikais. Įterpimas į 1, 2 ir 3 nusileidimo kilimėlius buvo pasirinktas atitinkamai naudojant Kan (50 μg/ml), Cm (35 μg/ml) ir Tet (5 μg/ml). Norint patvirtinti integraciją su kolonijų PGR, buvo naudojami pradmenys, galintys sustiprinti integruotų konstrukcijų ir gretimos genominės DNR jungtį. 1 ir 2 nusileidimo trinkelėse oYJP2164 (AATAAACAAATAGGCATGGTCTAAGAAACCATT) buvo naudojamas kaip gruntas, kuris jungiasi prie integruotos konstrukcijos. oYJP3436 (CCTGATCAGGTTCCGCGGATCCCGAATAAACGGTC) ir oYJP3526 (TGCCAAAGGCGATAGGTGAAATAATGTCGGCGACAGCGG) buvo naudojami kaip pradmenys, kurie suriša genominę DNR greta 1-ojo nusileidimo trinkelės ir atitinkamo nusileidimo taško Nr. 3 nusileidimo kilimėliui priekinis pradmuo, kuris jungiasi prie integruotos konstrukcijos galo į priekį, buvo naudojamas su pradmeniu oYJP2826 (AGAGATGACAGAAAAAATTTCATTCTGTGACAGAGAAAAAAGTAGCCGAAGATG), kad sustiprintų jungtį tarp 3 nusileidimo taško ir gretimos genominės DNR. Amplikono dydis buvo patvirtintas naudojant gelio elektroforezę. Visus tris žymenis galima pašalinti transformuojant padermes, turinčias tūpimo padėklus su įterptomis naudingosiomis apkrovomis, su pE-FLP plazmide, turinčia temperatūrai jautrią replikacijos pradžią (St-Pierre). ir kt, 2013). Tam kiekviena padermė buvo kultivuojama per naktį 2 ml LB terpės su atitinkamais antibiotikais (Cm (35 μg/ml), Kan (50 μg/ml) ir Tet (5 μg/ml)) 37 °C ir 250 °C temperatūroje. rpm New Brunswick Innova 44 Shaker (Eppendorf, JAV), naudojant Falcon 14 ml apvaliadugnius polipropileno vamzdelius (Corning, JAV, 352059). Kitą dieną ląstelės buvo 200 kartų praskiestos 4 ml LB terpės be antibiotikų ir inkubuojamos 37 °C temperatūroje ir 250 aps./min. New Brunswick Innova 44 Shaker, naudojant Falcon 14 ml apvaliadugnius polipropileno mėgintuvėlius (Corning, JAV, 352059). ) 2 valandas, kol pasieks OD600 = 0,4. Tada ląstelės buvo surinktos centrifuguojant (4700 g, 4°C, 10 min.), naudojant Legend XFR centrifugą. Ląstelių granulės buvo plaunamos 1 ml atšaldyto 10% glicerolio ir nusukamos naudojant šaldytuvo centrifugą (Eppendorf, JAV) esant 21 000 g ir 4°C 30 s tris kartus. Galiausiai ląstelių granulės buvo resuspenduojamos į 75 μl atšaldyto 10% glicerolio, gaunant elektrokompetentingas ląsteles, kurios vėliau buvo transformuotos 20 ng pE-FLP (St-Pierre). ir kt, 2013), po to regeneruojama 1 ml SOC terpėje ir inkubuojama 30 °C temperatūroje 30 min. Tada ląstelės buvo padengtos LB agaro plokštelėmis (2%) su Amp (100 μg / ml) ir inkubuojamos 30 ° C temperatūroje per naktį. Kitą dieną trys atskiros kolonijos buvo padengtos LB agaro plokštelėmis (2%) be antibiotikų ir inkubuojamos 37 ° C temperatūroje per naktį. Po to trys kolonijos iš kiekvieno ruožo buvo auginamos LB terpėje su keturiais antibiotikais (Amp (100 μg/ml), Cm (35 μg/ml), Kan (50 μg/ml) ir Tet (5 μg/ml)) 37 °C temperatūroje. °C ir 1000 aps./min. 16 val. ant ELMI plokštelės purtytuvo, naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662). Ląstelės, kurios neaugo visuose keturiuose antibiotikuose, buvo išmargintos ir vėliau panaudotos kaip paskutinės padermės.

    RPU (santykinių promotoriaus vienetų) apskaičiavimas

    Escherichia coli MG1655, kuriame yra RPUG etaloninis promotorius (YJP_MKC254) buvo išbrauktas ant LB agaro plokštelės be antibiotikų ir inkubuojamas per naktį 37 ° C temperatūroje. Po to atskiros kolonijos, paimtos iš plokštelės, buvo pasėtos į 200 μl M9 terpės be antibiotikų ir inkubuojamos per naktį. Visi kultivavimo etapai buvo atlikti 37 °C temperatūroje ir 1000 aps./min. ELMI plokštelių purtyklėje, naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662). Kitą dieną ląstelės buvo praskiestos 185 kartus į 200 μl M9 terpės be antibiotikų ir inkubuojamos 3 valandas. Tada ląstelės vėl buvo praskiestos 700 kartų į 200 μl M9 terpės be antibiotikų ir inkubuojamos 5 valandas. Tada 30 μl alikvotinė dalis buvo perkelta į 200 μl 1 × PBS tirpalo su 2 mg / ml kanamicino ir įvertinta naudojant srauto citometriją. Paversti promotoriaus fluorescenciją iš au (<YFP>išmatuotas) į RPUG, naudojama ši lygtis: [(<YFP>išmatuotas)-(<YFP>tuščias)]/[(<YFP>RPU)-(<YFP>tuščias)], kur <YFP>tuščias yra laukinio tipo autofluorescencija E. coli MG1655.

    RPUGsrauto konvertavimas į RNAP

    RPUG buvo konvertuotas į RNAP srautą, padauginus anksčiau apskaičiuotą konversijos koeficientą 1 RPU = 0,019 RNAP/s vienai DNR (B. Shao, J. Rammohan, DA Anderson, N. Alperovich, D. Ross ir CA Voigt, neskelbti duomenys) ir kopiją DNR skaičius, kuriame yra 1 nusileidimo aikštelė. Palyginus Tn5 ekspresijos duomenis 7 vietoje, kurioje yra nusileidimo taškas Nr. 1, ir vietos Nr. 3, vietos, esančios greta vienos genomo kopijos srities, buvo įvertintas 3,5 nusileidimo kilimėlio kopijos skaičius. Atminkite, kad RPU ir RPU naudojamas tas pats promotoriusG standartinė kasetė, ir daroma prielaida, kad šis promotorius sukuria tą patį konstitucinį srautą abiejose vietose. Todėl 1 RPUG buvo konvertuotas į 0,067 RNAP/s.

    Jutiklio charakteristika

    Padermė, turinti septynis jutiklius, esančius 3 tūpimo aikštelėje (YJP_MKC174), buvo transformuota reporterio plazmide su promotoriumi, sujungtu su yfp (plYJP067 (promoterio pavadinimas)), kuris reaguoja į septynis reguliatorius (AraC, LacI, TetR, CymR AM, VanRAM, CinR AM ir TtgR AM) ir išteptas ant LB agaro (2%) plokštelių su Kan (50 μg) /ml). Pavienės kolonijos buvo pasėtos į 200 μl M9 terpės su Kan (50 μg/ml) buvo auginamos per naktį 37 ° C temperatūroje ir 1000 aps./min. ELMI plokštelių purtyklėje, naudojant Nunc™ 96 šulinėlių plokšteles. Kitą dieną ląstelės buvo 185 kartus praskiestos 200 μl šviežios M9 terpės be jokių antibiotikų ir tris valandas inkubuojamos 37 °C temperatūroje ir 1000 aps./min. greičiu ELMI plokštelių purtyklėje, naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662). Tada ląstelės buvo 700 kartų praskiestos 200 μl šviežios M9 terpės (be antibiotikų) su atitinkamais induktoriais ir 5,5 valandos inkubuojamos ELMI plokštelių purtyklėje 37 °C temperatūroje ir 1000 aps./min. naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV). , 249662). Tada arba 12,5 mM L-arabinozės (Sigma-Aldrich, JAV, A3256), 1 mM IPTG (GoldBio, JAV, I2481C), 20 ng/μl aTc (Sigma-Aldrich, JAV, 37919), 500 μM 4-izopropilbenzo rūgšties (Sigma-Aldrich, JAV, 268402), 200 μM vanilės rūgšties (Sigma-Aldrich, JAV, H36001), 10 μM OHC14 (Sigma-Aldrich, JAV, 51481) arba 1 mM naringenino (Sigma-Aldrich93, JAV) buvo naudojamas jutikliams sukelti. Po 5,5 val. srauto citometrijos analizei buvo pridėta 30 μl ląstelių į 200 μl 1 × PBS su 2 mg/ml Kan.

    NOT/NO vartų charakteristika

    Kiekviena padermė, turinti NOT vartus, buvo išbraukta ant LB agaro (2%) plokštelių su Kan (50 μg/ml) ir Cm (35 μg/ml) antibiotikais. Viena kolonija buvo paimta ir inokuliuota į M9 terpę su Kan (50 μg / ml) ir Cm (35 μg / ml), kad būtų galima auginti per naktį ELMI plokštelių purtykloje 37 ° C temperatūroje ir 1000 aps./min. Ląstelių kultūros buvo atliktos naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662). Kitą dieną ląstelės buvo 185 kartus praskiestos 200 μl šviežios M9 terpės be antibiotikų ir 3 valandas inkubuojamos ELMI plokštelių purtyklėje 37 ° C temperatūroje ir 1000 aps./min. Po 3 valandų ląstelės vėl buvo praskiestos 700 kartų į 200 μl šviežios M9 terpės be antibiotikų ir inkubuojamos su induktoriais dar 5, 5 valandos ELMI plokštelių purtyklėje 37 ° C temperatūroje ir 1000 aps./min. Po 5,5 val. srauto citometrijos analizei buvo pridėta 30 μl ląstelių į 200 μl 1 × PBS su 2 mg/ml Kan. Norint išmatuoti OD, 150 μl alikvotinės dalys buvo perkeltos į optiškai skaidrias Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, USA, 165305), kad būtų galima išmatuoti OD.600 naudojant hibridinį mikroplokštelių skaitytuvą BioTek Synergy H1 (BioTek Instruments Inc, JAV). Norint išmatuoti vartų atsako funkcijas, įvesties ir išvesties promotoriaus veikla, išmatuota kaip vidutinė YFP fluorescencija, buvo konvertuota į RPU.G. Atsakymo funkcijos atitiko Hillo lygtį y = ymin + ((ymaks − ymin)/(1 + (x/K) n ), naudojant vidinį Python scenarijų.

    Grandinių projektavimo automatizavimas naudojant Cello 2.0

    Cello 2.0 programinė įranga (cellocad.org) ir kodas yra prieinami atviro kodo GitHub (github.com/CIDARLAB/Cello-v2). Atminkite, kad šiame dokumente pateiktas UCF yra skirtas Cello 2.0 ir neveiks su sena žiniatinklio violončelės sąsaja. Buvo sukurtas UCF failas (Eco2C1G3T1.UCF.json) (S1 priedo failas), skirtas užkoduoti Hill parametrus NOT vartų atsako funkcijoms vartų bibliotekoje (1 lentelė), kiekvieno vartų citometrijos pasiskirstymą, Eugene taisykles, nusileidimo trinkelės vietos informaciją ir augimo tyrimo sąlygos. Jutiklio išvesties promotoriaus veikla (PBadmc, Ymin = 0,04, Ymaks = 3,33 pTac, Ymin = 0,02, Ymaks = 4,20 pTet, Ymin = 0,02, Ymaks = 5,41 pCymRC, Ymin = 0,19, Ymaks = 2,39 pVanCC, Ymin = 0,02, Ymaks = 3,79 pCin, Ymin = 0,01, Ymaks = 4,38 ir PTtgR, Ymin = 0,01, Ymaks = 0,22 (RPUG)), kiekvienam grandinės dizainui buvo naudojamas UCF failas, tiesos lentelė, suformuluota kaip „Verilog“ failas, ir augimo balo riba (nustatyta į 0,75). „Cello 2.0“ buvo paleista vietoje naudojant „Cello 2.0“ API.

    Genetinės grandinės konstrukcija

    Genetinės grandinės pirmiausia buvo suskaidytos ir klonuotos į dvi plazmides, plYJP066 (KanR) ir plYJP070 (CmR), kurios atitinkamai nukreiptos į nusileidimo padėklus Nr. 1 ir Nr. 2, naudojant II tipo surinkimą, kaip aprašyta anksčiau (Nielsen). ir kt, 2016 Shin ir kt, 2020). Transkripcijos vienetų tvarką grandinėje priskyrė Cello 2.0 pagal EUGENE taisykles. Trumpai tariant, kiekvienas grandinės transkripcijos vienetas buvo subklonuotas į plYJP080 (AmpR) (priedas S14 pav. ir priedo lentelė S6) stuburus su p15a kilme, naudojant II tipo agregatą su BsaI (New England Biolabs, JAV, R3733) ir T4 ligaze HC. („Promega“, JAV, M1794). Reakcijos mišinys buvo paruoštas pridedant 40 fmol kiekvieno DNR fragmento, 1 μl BsaI, 0,5 μl T4 ligazės HC, 1,5 μl T4 ligazės buferio (Promega, JAV, M1794) ir vandens iki 15 μl. Tada reakcijos mišinys buvo 30 kartų perkeltas nuo 37 ° C (5 min.) iki 16 ° C (3 min.), todėl buvo gauti transkripcijos vienetai (plYJP080 plazmidėse), kurie yra paruošti naudoti genetinės grandinės konstravimui. Kiekvienai sukurtai genetinei grandinei visi naudojami transkripcijos vienetai buvo surinkti į visą grandinę naudojant BbsI (New England Biolabs, JAV, R3539) ir T4 ligazę HC (Promega, JAV, M1794). Reakcijos mišinyje buvo 40 fmol kiekvienos plYJP080 plazmidės, turinčios transkripcijos vienetą, 1 μl BbsI, 0,5 μl T4 ligazės HC, 1,5 μl T4 ligazės buferio (Promega, JAV, M1794) ir vandens iki 15 μl. Po to reakcijos mišinys buvo 50 kartų perkeltas nuo 37 ° C (5 min.) iki 16 ° C (3 min.) surinkimo reakcijai, todėl susidarė du nauji plazmidės pagrindai plYJP066 ir plYJP070 plazmidės. Tada šios dvi plazmidės buvo integruotos į genomą, kaip aprašyta aukščiau. Antibiotikų žymenys buvo pašalinti transformuojant pE-FLP (St-Pierre ir kt, 2013). pE-FLP plazmidė buvo išgydyta inkubuojant ląsteles 37 °C temperatūroje, kaip aprašyta anksčiau (Priedo S14 pav.).

    Genetinės grandinės apibūdinimas

    Padermės, turinčios genetinę grandinę, buvo išbrauktos ant LB agaro (2%) plokštelės be antibiotikų. E. coli MG1655 laukinio tipo ir RPUG standartinės padermės buvo išmargintos kaip kontrolė. Atskiros kolonijos buvo paimtos iš plokštelių ir pasėtos į M9 terpę be antibiotikų. Ląstelės buvo inkubuojamos per naktį 37 ° C temperatūroje ir 1000 aps./min. ELMI plokštelių purtyklėje, naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662). Kitą dieną ląstelės buvo 185 kartus praskiestos 200 μl šviežios M9 terpės be antibiotikų ir tris valandas inkubuojamos 37 °C temperatūroje, 1000 aps./min. greičiu ELMI plokštelių purtyklėje, naudojant Nunc™ 96 šulinėlių plokšteles (Thermo Scientific, JAV, 249662). Po trijų valandų ląstelės buvo 700 kartų praskiestos M9 terpėje be antibiotikų ir sukeltos atitinkamais induktorių deriniais, tokiais kaip 1 mM IPTG, 12,5 mM L-arabinozė, 20 ng/μl aTc, 10 μM OHC14 ir 200 μM vanilino rūgštis. buvo naudojami, kaip nurodyta Cello 2.0 prognozėje. Po 5,5 val. srauto citometrijos analizei buvo pridėta 30 μl ląstelių į 200 μl 1 × PBS su 2 mg/ml Kan. Vidutinė YFP fluorescencija iš kiekvieno mėginio buvo ištirta naudojant FlowJo (TreeStar, Inc., JAV) programinę įrangą ir konvertuota į RPU.G.

    Bendrojo RNAP srauto apskaičiavimas

    Kiekvieno NOT ir NOR vartų įvesties promotoriaus aktyvumas (RNAP srautas) 0xF1 grandinėje buvo apskaičiuotas kiekvienai būsenai naudojant Cello 2.0 programinės įrangos paketą. Bendras grandinės RNAP srautas buvo apskaičiuotas sudedant promotoriaus veiklą visuose grandinės vartuose, įskaitant jutiklių išvesties promotorius. Genomu koduotai 0xF1 grandinei naudojome UCF failą Eco2C1G3T1, tiesos lentelę (0xF1.v) ir genomo koduojamą jutiklio išvesties promotoriaus veiklą (aprašyta aukščiau). UCF buvo pagrįstas įprastu tandeminio promotoriaus veiklos priedų modeliu ir nebuvo užkoduotas tandemo kelių blokavimo taisyklėmis. Plazmidės koduotai 0xF1 grandinei naudojome UCF failą Eco1C2G2T2, tiesos lentelę (0xF1.v) ir plazmidės koduotą jutiklio išvesties promotoriaus veiklą (Pliuksas2, Ymin = 0,030, Ymaks = 2,234 pTac, Ymin = 0,018, Ymaks = 1,689 pTet, Ymin = 0,040, Ymaks = 1,967 ir PCin, Ymin = 0,005, Ymaks = 3,178 (RPU)). UCF buvo užkoduotas nepridedančiu tandemo promotoriaus modeliu. Kai grandinės buvo suprojektuotos, projektavimo išvesties failai (0xF1_A000_logic_circuit.txt (genomas), 0xF1_A001_logic_circuit.txt (plazmidė)) buvo naudojami bendram grandinės naudojamam RNAP srautui apskaičiuoti.Iš kiekvieno failo buvo susumuotas kiekvieno grandinės NOT ir NOR vartų įvesties promotoriaus aktyvumas (nuo antro iki paskutinio stulpelio), kad būtų galima apskaičiuoti bendrą RNAP srautą. Bendras RNAP srautas, apskaičiuotas genomo koduotoms grandinėms (RPUG) buvo padalintas iš 6,33 (priedo S4 pav.), kad būtų konvertuotas RPUG į RPU. Bendras RNAP srautas plazmidės koduotai grandinei buvo apskaičiuotas RPU.

    Ilgalaikis stabilumo testas

    Plazmidės koduota 0xF1 grandinė buvo sukurta naudojant UCF p15a plazmidei (Eco1C2G2T2) ir buvo sukonstruota E. coli DH10β (Nielsen ir kt, 2016 Shin ir kt, 2020). The E. coli MG1655 padermė, turinti genomo koduojamą 0xF1 grandinę, buvo užtepta ant LB agaro (2%) plokštelių su Kan (50 μg/ml) ir Cm (35 μg/ml) antibiotikais ir auginama per naktį. The E. coli DH10β padermė, turinti plazmidės koduojamą 0xF1 grandinę, buvo uždėta ant LB agaro (2%) plokštelių, kuriose yra Kan (50 μg / ml), ir auginama per naktį. Kiekvienai iš jų buvo paimtos trys kolonijos ir auginamos M9 terpėje be antibiotikų. Kiekvieną dieną kiekviena kultūra buvo skiedžiama 10 4 kartus į 500 μl šviežios M9 terpės 96 gylių plokštelėse (USA Scientific, JAV, 1 896–2 000) su induktorių deriniu, nurodytu 5 pav. Po inkubacijos 8 valandas 37 °C ir 900 aps./min. Multitron Pro inkubatoriaus purtyklėje (In Vitro Technologies, VIC, Australija), 30 μl ląstelių buvo įpilta į 200 μl 1 × PBS su 2 mg/ml Kan srauto citometrijos analizei ir 100 μl ląstelių buvo sumaišyta. su 80% autoklavuoto glicerolio (VWR cheminė medžiaga BDH1172-1LP) ir laikoma –80 °C temperatūroje. Kita alikvotinė dalis buvo 100 kartų atskiesta į šviežią terpę su tais pačiais induktorių deriniais ir inkubuojama per naktį. Kartojant šį protokolą ciklas tęsėsi 12 dienų. Norėdami išmatuoti OD600 genomo ir plazmidės koduotų grandinių, atskiros kolonijos iš ruožo buvo pasėtos į M9 terpę ir inkubuojamos per naktį 37 ° C temperatūroje ir 1000 aps./min. ELMI plokštelių purtyklėje. Ląstelės, turinčios plazmidėmis koduotas genetines grandines, buvo inkubuojamos per naktį su Kan (50 μg / ml). Genomu užkoduotos grandinės buvo inkubuojamos per naktį be antibiotikų. Kitą dieną kiekviena kultūra buvo atskiesta 185 kartus į 3 ml šviežios M9 terpės ir 3 valandas auginama 37 °C temperatūroje ir 250 aps./min. Innova Shaker. Po trijų valandų OD600 kiekvienos kultūros (OD600) buvo išmatuotas naudojant Cary 50 Bio spektrofotometrą (Agilent, JAV). Išmatuotas OD600 buvo naudojamas norint apskaičiuoti mėginio kiekį, reikalingą tam pačiam ląstelių skaičiui perkelti į antrąjį skiedimą. Ląstelės buvo praskiestos

    700 kartų į 3 ml M9 terpę su atitinkamais induktoriais ir buvo auginami 5,5 valandos 37 °C temperatūroje ir 250 aps./min. Innova Shaker. Ląstelių augimas be grandinės buvo nustatytas naudojant bet kurį E. coli MG1655 su tuščiomis tūpimo trinkelėmis (YJP_MKC173) arba E. coli DH10β, turintis p15a plazmidę su Kan (50 μg/ml) atsparumo genu (pYJP018).


    Bakterijos

    Dvejetainis dalijimasis yra pirminės ląstelės padalijimas į dvi dukterines ląsteles, tai yra nelytinis prokariotų dauginimasis.

    Bakterijose genetinė rekombinacija gali vykti trimis būdais.

    1. Konjugacija

    2. Transformacija

    3. Transdukcija

    III. Prokariotų mityba

    Autotrofas (chemotrofinis arba fotosintetinis) / heterotrofas

    Mutualistai (simbiotinis) azoto‑fiksavimas Rhizobium bakterijos / žarnyno bakterijos žmonėms

    IV. BAKTERIJŲ KLASIFIKACIJA

    1. Trys pagrindinės formos: coccus / bacillus / spirillum

    2. Tos figūros gali būti suskirstytos į

    stafilokokas = klasteriai / strep = grandinės

    A. Bacillus B. Streptococcus C. Staphylococcus D. Diplococcus E. Spirllum F. Vibrio

    3. Gramo dėmės

    Naudojamas bakterijoms identifikuoti / Gram Positve = tamsiai violetinė / Gram Negative = rožinė


    Rekombinantinio apibūdinimas E. coli išreiškiantis arsR iš Rhodopseudomonas palustris CGA009, kuris rodo labai selektyvią arseno adsorbciją

    Ieškoma naujoviškų metodų, kaip sumažinti arseno (As) poveikį. Pranešama, kad As reguliuojantis baltymas (ArsR) turi didelį afinitetą ir specifiškumą arsenitui [As(III)]. Rhodopseudomonas palustris CGA009 yra geras pavyzdinis organizmas tiriant Kaip detoksikaciją dėl mažiausiai trijų ars operonai ir keturi skirtingi arsRRP1–4 ant genomo. Šiame tyrime keturi Escherichia coli talpinantis arsRRP1–4 gauti iš CGA009, buvo sukurti ir išbandyti dėl jų atsparumo As. Rezultatai tai parodė E. coli (arsRRP2) parodė stiprų atsparumą As (III), o jo augimo slopinimo greitis buvo tik 2,9%, kai buvo veikiamas 3,0 mmol/L As (III). Esant pH 7,0, E. coli (arsRRP2) parodė padidintą As adsorbcijos pajėgumą. As(III) (2,32 mg/g (sausos masės, dw)) ir 1,47 mg/g arsenato [As(V)] buvo adsorbuoti, o tai atitinkamai padidėjo 4,2 ir 1,3 karto, palyginti su kontroline paderme. Adsorbcijos procesas buvo gerai pritaikytas Langmuir izoterminiam režimui. E. coli (arsRRP2) (1.0

    82,2 % As (III), kai veikiama 10 μg/L As(III). Vario (II), cinko (II), chromo (III) ir švino (II) absorbcijos padidėjimo nepastebėta. Mūsų tyrimai tai atskleidė arsRRP1–4 iš CGA009 gali suteikti As(III) atsparumą E. coli (arsRRP2) parodė didžiausią atsparumą, selektyvumą ir adsorbcijos pajėgumą platesniame pH (5,0)

    15,0 g/L NaCl) diapazonas, ypač svarbus, nes gali pašalinti As(III) iš mažos koncentracijos As turinčio vandens.


    Išvados

    Adaptuoto žmogaus fiziologinių ir metabolinių reakcijų tyrimas E. coli kultūros ir substrato trikdžiai, pabrėžia parametrus, į kuriuos reikia atsižvelgti kuriant medžiagų apykaitos inžineriją ir proceso projektavimą, susijusį su didelio masto reaktoriaus veikimu.

    Ląstelės nedelsdamos reagavo į substrato perteklių, padidindamos jų įsisavinimo greitį ir atitinkamai intracelulinius srautus per kelias dešimtis sekundžių. Anglis buvo laikoma tarpląsteliniuose produktuose substrato šventės metu ir buvo sunaudojama bado fazės metu.

    Nepaisant labai kintančios dinamikos, energijos krūvio homeostazė buvo pastebėta kaip puikus atsako į sutrikimus tinkamumas, rodantis greitą medžiagų apykaitos reguliavimą.

    Pramoninei fermentacijai svarbiau ir svarbiau buvo 30 % sumažėjęs biomasės išeiga, atsirandantis pertraukiamo šėrimo metu, palyginti su etalonine pastovia būsena. Todėl energijos išsiliejimas buvo kompromisas dėl mikroorganizmo prisitaikymo dinamiškoje aplinkoje, siekiant tvirto augimo.

    Gauti rezultatai atskleidė kai kurias priežastis, dėl kurių sumažėjo ląstelių gamyklų našumas didinant mastelį. E. coli reaguoja į stresą, sukeltą substrato gradientų, pradėdamas specifinę medžiagų apykaitos strategiją. Norėdami ekonomiškai efektyviai pagerinti didelio masto bioprocesų našumą, turime toliau nustatyti prisitaikymo prie streso mechanizmus, substrato įsisavinimo ir kvėpavimo apribojimus, galimus energijos išsiliejimo kelius ir optimalius ląstelių augimo tikslus, derinant daugiafunkcinius metodus. .


    Žiūrėti video įrašą: Escherichia coli History, Morphology, Categories, toxins,Diseases,Importance MS Notebook. (Spalio Mėn 2022).