Informacija

Kaip aminorūgštys yra neutralios esant fiziologiniam pH?

Kaip aminorūgštys yra neutralios esant fiziologiniam pH?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Aminorūgštys su nejonizuojamomis šoninėmis grandinėmis yra cviterionai, kai jų fiziologinis pH yra 7,4. Taip sakoma mano knygoje. Bet nesuprantu kodėl. Karboksilo grupės Pka yra maždaug 3, o amino grupės pKa yra apie 9. Taigi aminorūgšties, neturinčios jonizuojančios šoninės grandinės, izoelektrinis taškas turėtų būti maždaug (9+3) /2 = 6. Jei pH 7,4, tai būtų šiek tiek neigiama, ar ne?

Be to, kas tiksliai yra pagrindinė aminorūgštis? Ar tai aminorūgštis, kurios PI vertė yra didesnė nei 7?

Ačiū.


Jūs teisus, daugumos aminorūgščių pI yra maždaug 6, todėl jos yra šiek tiek neigiamos, kai pH yra 7.

Izoelektrinis taškas priklauso nuo amino ir karboksirūgščių grupių bei šoninės grandinės grupių. Pvz. lizino šoninėje grandinėje yra amino grupė, todėl jo pI yra 9,74.


Jei aminorūgštis turi dvi amino grupes ir tik vieną karboksilo grupę (kaip argininas ir lizinas), tada jos yra teigiamai įkrautos (++ prieš -), esant neutraliam pH. Kita vertus, jei aminorūgštys turi dvi karboksilo grupes ir tik vieną amino grupę (pvz., glutamo rūgštį ir asparto rūgštį), jos yra neigiamai įkraunamos esant pH 7 (-- prieš +). Jūs nesate teisus, kad grupės yra tikrai neutralios. Karboksilo grupė yra neigiamai įkrauta tirpale, kuris yra daug didesnis nei karboksilo grupės pKa (arginino pH yra 2,48). Tas pats pasakytina ir apie amino grupes (arginino pKb pH yra 11,5). Taigi, esant pH 9,5, teigiamai įkrautos amino grupės ir neutralios amino grupės santykis yra 100:1 (esant pKb būtų 50:50). Esant pH 4,48, arginino karboksilo grupė būtų 1:100 neigiamai įkrauta, palyginti su neutralia. Taigi, esant pH 7, visa karboksilo grupė yra neigiamai įkrauta (COO-), o visos amino grupės (2 iš jų) yra visiškai teigiamai įkrautos (NH3+). Grynasis krūvis yra plius 1, jei argininas yra 7 pH.


Kai pH 7,4, karboksilo grupė dažniausiai yra COO pavidalu-, o amino grupė yra NH3+. Taigi, kai molekulė turi abi grupes, pavyzdžiui, aminorūgštį, visa molekulė yra neutrali. Kadangi vandenilis yra cviterionas (vienodai + ir - krūviai), vandenilis taip pat gali apsiversti tarp amino ir karboksilo grupių. Padaryti molekulę „tikrai“ neutralia, nes abi grupės nėra įkrautos.

Bazinė aminorūgštis savo šoninėje grandinėje turi bazinę grupę, tokią kaip amino grupė (argininas).


Techniškai taip, dauguma aminorūgščių bus šiek tiek neigiamai įkrautos esant fiziologiniam pH. Tačiau turime suprasti, ką tai reiškia. Paimkime alaniną kaip pavyzdį. Bet kuri atskira alanino molekulė gali būti neįkrauta arba turėti sveikąjį grynąjį krūvį – ji arba protonuota, arba ne. Niekada nerasite „iš dalies įkrautos“ alanino molekulės. Tačiau jei tirpalo fiziologiniame pH yra krūva alanino molekulių, jos ne visos elgsis lygiai taip pat tuo pačiu metu. Viena molekulė gali turėti protonuotą N galą, o kita - deprotonuotą N galą. Esant fiziologiniam pH, C galas yra beveik visiškai deprotonuotas, todėl tereikia atkreipti dėmesį į N galą. Galime naudoti Hendersono-Hasselbacho lygtį, kad išsiaiškintume, kiek procentų alanino molekulių turės protonuotą (teigiamai įkrautą) N-galą ir kiek procentų yra deprotonuota. pH = pKa + log(deprotonuotas/protonuotas). Jei pakeisime žinomais skaičiais, gausime 7,4 = 9,5 + log (deprotonuotas / protonuotas)

Todėl -2,1 = log(deprot/prot) ir 10^-2,1 = deprot/prot = 0,008. Tai reiškia, kad iš 1000 alanino molekulių maždaug 8 iš jų yra deprotonuotos ir todėl neigiamai įkrautos. Kiti 992 yra zwitterionai. Taigi visais tikslais alaninas yra neutralus esant fiziologiniam pH.


9.3: aminorūgštys, baltymai ir pH

Be to, kad išnagrinėsime, kaip stiprios rūgšties ar bazės pridėjimas paveikia buferinį tirpalą, taip pat galime pažvelgti į pH poveikį konkrečiai rūgščiai ar bazei. Tai ypač svarbu biologinėse sistemose, kuriose yra daug silpnų rūgščių ar bazių grupių, kurias gali paveikti pH. Pavyzdžiui, baltymuose yra ir silpnai rūgštinės &ndashCOOH, ir silpnai bazinės &ndashNH2 grupės. 1,0 M paprastos karboksirūgšties, tokios kaip acto rūgštis, tirpalo pH yra

2.8 pasirodo, kad dauguma karboksirūgščių elgiasi panašiai. Jei manipuliuojame pH, pavyzdžiui, pridedant stiprios bazės, acto rūgštis reaguoja su baze, sudarydama acetato joną. Remiantis Henderson&ndash Hasselbalch lygtimi, kai [acetatas] = [acto rūgštis], pH yra lygus rūgšties&rsquos pKa, tai yra 4,74. Didėjant pH, acetato koncentracija taip pat turi didėti iki pH

7 (maždaug normalus fiziologinis pH). Šiuo metu acto rūgšties koncentracija iš tiesų yra labai maža. Bazės ir rūgšties santykis yra apie 200/1. Tai yra, esant fiziologiniam pH, grupės, tokios kaip karboksirūgštys, yra deprotonuojamos ir egzistuoja karboksilato (neigiamai įkrautos) formos.

Ir atvirkščiai, jei pažvelgsime į amino grupę (&ndashNH2) baltymo, tai iš tikrųjų yra bazinė konjuguotos rūgšties ir bazės poros dalis, kurioje rūgštis yra protonuota forma &ndashNH3 + . pKa &ndashNH3+ grupės paprastai yra

9. Esant pH 9, yra vienodas kiekis protonų (&ndash NH2) ir neprotonuotos formos (&ndashNH3 + ). Taigi, jei pakeisime pH, pridėdami rūgšties, &ndash NH koncentracija3 + forma didėja, kai pagrindinė forma &ndashNH2 yra protonuotas. Esant pH

7 &ndashNH yra mažai2 likusi forma.

Įdomu tai, kad aminorūgštis (parodyta paveikslėlyje) niekada neegzistuoja tokioje būsenoje, kurioje tiek amino rūgštis (&ndashNH)2) grupę ir karboksirūgštį (&ndashCO2H) egzistuoja tuo pačiu metu. &ldquoneutrali&rdquo rūšis iš tikrųjų yra ta, kurioje &ndashNH3 + /&ndashCO2 &ndash yra. Šis cvitteris (tai yra neutralios molekulės, turinčios teigiamą ir neigiamą elektrinį krūvį skirtingose ​​vietose, iš vokiško cviterio, reiškiančio &ldquotarp&rdquo) yra vyraujanti forma esant fiziologiniam pH.

Baltymus daugiausia (kartais vien) sudaro aminorūgščių polimerai, žinomi kaip polipeptidai. Polipeptide amino (&ndashNH2) ir karboksirūgštį (&ndashCO2H) aminorūgščių grupės yra sujungtos kartu, kad susidarytų peptidinė jungtis (žr. pav.).

Susidariusi amido grupė (peptidinė jungtis) fiziologinėmis sąlygomis nėra nei rūgštinė, nei bazinė 182 . Be to, daugelis baltymuose esančių aminorūgščių turi rūgštines (asparto rūgštis arba glutamo rūgštis) arba bazines (lizinas, argininas arba histidinas) šonines grandines. Aplinkos pH turi įtakos baltymo molekulės konformacijoms ir šių įkrautų šoninių grandinių sąveikai (spontaniškos prigimtinės molekulės konformacijos vadinamos baltymo lankstymu). Dėl &ldquonormal&rdquo aplinkos pokyčių gali pasikeisti baltymų struktūra, o tai savo ruožtu gali pakeisti biologinį aktyvumą. Kai kuriais atvejais baltymų aktyvumą reguliuoja aplinkos pH. Kitais atvejais pH pokyčiai gali sukelti netinkamą baltymų susilankstymą (arba denatūraciją, o tai gyvuose organizmuose gali sutrikdyti ląstelių veiklą arba mirti). Pavyzdžiui: jei šios grupės yra protonuotos arba deprotonuotos, elektroninė aplinka tame baltymo regione gali drastiškai pasikeisti, o tai gali reikšti, kad baltymas ne tik pakeis sąveiką su kitomis rūšimis, bet ir gali pasikeisti jo forma taip, kad jis būtų kuo mažesnis. atstumiančią sąveiką arba sukuria naujas patrauklias sąveikas. Nedideli baltymo formos pokyčiai gali turėti didelės įtakos baltymo sąveikai su kitomis molekulėmis ir, jei tai katalizatorius, jo efektyvumui ir specifiškumui. Tiesą sakant, yra atvejų, kai aplinkos pH naudojamas baltymų aktyvumui reguliuoti.


Klasifikacija

Be amino ir karboksilo grupių, aminorūgštys turi šoninę grandinę arba R grupę, prijungtą prie &alfa-anglies. Kiekviena aminorūgštis turi unikalių savybių, atsirandančių dėl jos R grupės dydžio, formos, tirpumo ir jonizacijos savybių. Dėl to aminorūgščių šoninės grandinės daro didelį poveikį baltymų struktūrai ir biologiniam aktyvumui. Nors aminorūgštys gali būti klasifikuojamos įvairiais būdais, vienas įprastas būdas yra jas klasifikuoti pagal tai, ar funkcinė grupė šoninėje grandinėje esant neutraliam pH yra nepolinė, polinė, bet neįkrauta, neigiamai įkrauta ar teigiamai įkrauta. 20 aminorūgščių struktūros ir pavadinimai, jų vienos ir trijų raidžių santrumpos bei kai kurios jų skiriamosios savybės pateiktos (PageIndex<1>) lentelėje.

Lentelė (PageIndex<1>): įprastos aminorūgštys, randamos baltymuose
Dažnas vardas Santrumpa Struktūrinė formulė (esant pH 6) Molinė masė Išskirtinis bruožas
Aminorūgštys su nepoline R grupe
glicinas gly (G) 75 vienintelė aminorūgštis, kuriai trūksta chiralinės anglies
alaninas ala (A) 89 &mdash
valinas val (V) 117 šakotos grandinės aminorūgštis
leucinas lėja (L) 131 šakotos grandinės aminorūgštis
izoleucinas ile (aš) 131 nepakeičiama aminorūgštis, nes dauguma gyvūnų negali susintetinti šakotos grandinės aminorūgščių
fenilalaninas phe (F) 165 taip pat priskiriama aromatinėms aminorūgštims
triptofanas trp (W) 204 taip pat priskiriama aromatinėms aminorūgštims
metioninas susitiko (M) 149 šoninė grandinė veikia kaip metilo grupės donoras
prolinas Pro (P) 115 yra antrinė amino grupė, vadinama an &alfa-imino rūgštis
Aminorūgštys su poline, bet neutralia R grupe
serinas ser (S) 105 randama daugelio fermentų aktyvioje vietoje
treonino th (T) 119 pavadintas dėl savo panašumo į cukraus trejetą
cisteinas cys (C) 121 oksiduojant dvi cisteino molekules cistinas
tirozino Tyras (Y) 181 taip pat priskiriama aromatinėms aminorūgštims
asparaginas asn (N) 132 asparto rūgšties amidas
glutaminas gln (Q) 146 glutamo rūgšties amidas
Aminorūgštys su neigiamai įkrauta R grupe
asparto rūgštis asp (D) 132 karboksilo grupės yra jonizuojamos esant fiziologiniam pH, taip pat žinomam kaip aspartatas
glutamo rūgštis gluos (E) 146 karboksilo grupės jonizuojamos esant fiziologiniam pH, dar vadinamam glutamatu
Aminorūgštys su teigiamai įkrauta R grupe
histidinas jo (H) 155 vienintelė aminorūgštis, kurios R grupė turi pKa (6,0) artimas fiziologiniam pH
lizinas lys (K) 147 &mdash
argininas arg (R) 175 beveik tokia pat stipri bazė kaip natrio hidroksidas

Pirmoji išskirta aminorūgštis buvo asparaginas 1806 m. Ji buvo gauta iš baltymų, esančių šparagų sultyse (iš čia ir kilo pavadinimas). Glicinas, pagrindinė aminorūgštis, esanti želatinoje, buvo pavadinta dėl saldaus skonio (graikų k glykys, reiškiantis &ldquosweet&rdquo). Kai kuriais atvejais baltyme randama aminorūgštis iš tikrųjų yra vienos iš 20 įprastų aminorūgščių darinys (vienas iš tokių darinių yra hidroksiprolinas). Modifikacija įvyksta po to aminorūgštis buvo surinkta į baltymą.


DMCA skundas

Jei manote, kad svetainėje pasiekiamas turinys (kaip apibrėžta mūsų paslaugų teikimo sąlygose) pažeidžia vieną ar daugiau jūsų autorių teisių, praneškite mums, nurodydami raštišką pranešimą („Pranešimas apie pažeidimą“), kuriame nurodyta toliau aprašyta informacija. toliau išvardytas agentas. Jei „Varsity Tutors“ imasi veiksmų reaguodama į pranešimą apie pažeidimą, ji sąžiningai bandys susisiekti su šalimi, kuri padarė tokį turinį prieinamą, naudodama naujausią el. pašto adresą, kurį tokia šalis suteikė „Varsity Tutors“.

Jūsų pranešimas apie pažeidimą gali būti persiųstas šaliai, kuri padarė turinį prieinamą, arba trečiosioms šalims, pvz., ChillingEffects.org.

Informuojame, kad būsite atsakingas už žalą (įskaitant išlaidas ir advokatų honorarus), jei iš esmės klaidingai pateiksite, kad produktas ar veikla pažeidžia jūsų autorių teises. Taigi, jei nesate tikri, kad turinys, esantis svetainėje arba į kurį pateikiama nuoroda, pažeidžia jūsų autorių teises, pirmiausia turėtumėte susisiekti su advokatu.

Norėdami pateikti pranešimą, atlikite šiuos veiksmus:

Turite įtraukti šiuos dalykus:

fizinis arba elektroninis autorių teisių savininko arba asmens, įgalioto veikti jo vardu, parašas. Autorių teisių, kurios, kaip teigiama, buvo pažeistos, identifikavimas Turinio, kuris, jūsų nuomone, pažeidžia jūsų autorių teises, pobūdžio ir tikslios vietos aprašymas. išsami informacija, leidžianti Varsity Tutors rasti ir teigiamai identifikuoti tą turinį, pavyzdžiui, mums reikia nuorodos į konkretų klausimą (ne tik klausimo pavadinimą), kuriame būtų turinys ir aprašymas, kuri konkreti klausimo dalis – vaizdas, nuoroda, tekstas ir tt – jūsų skunde nurodomas jūsų vardas, pavardė, adresas, telefono numeris ir el. pašto adresas bei jūsų pareiškimas: (a) kad sąžiningai tikite, kad turinio, kuris, jūsų nuomone, pažeidžia jūsų autorių teises, naudojimas yra neįgaliojo įstatymai arba autorių teisių savininkas arba tokio savininko atstovas (b) kad visa pranešime apie pažeidimą esanti informacija yra tiksli, ir (c) bausme už melagingus parodymus, kad esate arba autorių teisių savininkas arba asmuo, įgaliotas veikti jų vardu.

Nusiųskite savo skundą mūsų paskirtam atstovui adresu:

Charles Cohn Varsity Tutors LLC
101 S. Hanley g., Suite 300
Sent Luisas, MO 63105


Metodai

Medžiagos

3H pažymėtos aminorūgštys buvo iš Amersham. Ampicilinas, G418, higromicinas B, fleomicinas, M-199 (vidutinė-199) ir nepažymėtos L-aminorūgštys buvo iš Sigma. Fetal bovine serum (FBS) buvo iš Biological Industries. Visi kiti reagentai buvo analitinės kokybės.

Leishmania ląstelių kultūra

Kloninė linija L. donovani 1SR buvo naudojamas visuose eksperimentuose 25 . Siekiant užtikrinti kloninį ląstelių linijos pobūdį, šviežios kultūros buvo pasėtos naudojant atskiras promastigotų kolonijas, paimtas iš M-199 agaro plokštelių. Promastigotai buvo auginami 26°02009°C temperatūroje M-199, papildytu 10% FBS.

Western blot analizė

Western blot analizė buvo atlikta, kaip aprašyta anksčiau 9 . Trumpai tariant, 10 8 log fazės promastigotų ląstelės buvo surinktos, du kartus plaunamos lediniu fosfatu buferiniu tirpalu (PBS) ir pakartotinai centrifuguojamos. Gautos nuosėdos buvo pakartotinai suspenduotos Laemmli buferyje ir po to 2 sekundės apdorotos ultragarsu, kad būtų užtikrintas denatūravimas. Druska ekstrahuotų membranų paruošimas buvo atliktas taip, kaip aprašyta 26 . Prieš perkeliant į nitroceliuliozės membraną, visas baltymas buvo tiriamas SDS / PAGE (mini-PROTEAN Bio-Rad Laboratories). Membranos buvo užblokuotos 10 % (m/v) neriebiais džiovinto nugriebto pieno milteliais PBST (PBS, kuriame yra 0,1 % Tween 20), inkubuojamos su anti-LdAAP24 arba anti-HA (1:2000 praskiedimu) antikūnais 1  val. kambario temperatūroje (22 ଌ), plaunama ir inkubuojama su antriniais ožkos anti-triušio HRP (krienų peroksidazės) antikūnais (1:10000 praskiedimu).

Imunofluorescencinės analizės

Imunofluorescencijai nustatyti vidutinio logaritmo promastigotai buvo du kartus plaunami PBS, o po to fiksuojami 1% formaldehido / PBS tirpale ant stiklelio 10 min., o po to pralaidumas buvo veikiamas 0,2% Triton X-100/PBS 10 min. Ląstelės buvo inkubuojamos su blokuojančiu tirpalu [10 % (t/v) neriebių džiovintų nugriebto pieno miltelių/PBST] 30 min kambario temperatūroje, inkubuojamos su anti-LdAAP24 arba anti-HA antikūnais (1:200 praskiedimu) 1 min. #x02009h ir po to inkubuojamas su antriniais polikloniniais ožkos anti-triušio IgG fluorescenciniais antikūnais (1:500 praskiedimas Dy-light 549 Red Jackson) 1 h tamsoje kambario temperatūroje. Galiausiai ląstelės buvo plaunamos PBST ir papildytos 5 μl DAPI (4′,6-diamidino-2-fenilindolis 0,5 μg/ml Fluka). Fluorescencinė analizė buvo atlikta naudojant konfokalinį fluorescencinį mikroskopą (Axiovert 200M Zeiss).

Klonavimas ir ekspresija

PCR sustiprintas LdAAP24 (atvirieji skaitymo rėmeliai (ORF) LinJ10.0760 ir LinJ10.0770), taip pat sutrumpintos transporterio ir #x02019s ORF versijos buvo klonuotos į Leishmania ekspresijos vektoriai pNUS-HnB 27 tarp XhoI ir KpnI vietų. Tirpusis N galas buvo klonuotas į pNUS-HnD 27 tarp XhoI ir KpnI vietų. Visos konstrukcijos, išskyrus 𹐘LdAAP24, buvo pažymėtos HA žyma C gale. Norėdami įsitikinti, kad kiekvienos konstrukcijos numatoma topologija nebuvo paveikta, naudojame TMHMM 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) 28 . Visų konstrukcijų pradmenys pateikti S1 lentelėje. Atrankai ląstelės buvo auginamos promastigotų terpėje, turinčioje fleomicino arba blasticidino antibiotikų. Sėkminga ekspresija buvo patvirtinta Western blot analize.

RNR sekos nustatymas

RNR-seq bibliotekos buvo paruoštos dviem metodais. Splice Leader (SL) RNR-seq bibliotekos, praturtinančios 5′ mRNR galą, buvo paruoštos taip, kaip aprašyta kitur (//www.ncbi.nlm.nih.gov/pubmed/?term=23382545). PolyA RNA-seq bibliotekos, kurios yra praturtintos 3′ mRNR galu, buvo paruoštos panašiai, tikimasi, kad pirmosios grandinės sintezei buvo naudojamas oligo (dT) pradmuo (TCCGATCTCTTTTTTV), atsitiktinis heksamero pradmuo (TCCGATCTGANNNNNNN). antrosios grandinės sintezei ir PGR amplifikacijai buvo atliktas naudojant seq pradmenį-CT (AATGATACGGCGACCACCGACACTCTTTCCCTACACGACGCTCTTCCGATCTCT) ir R-pradmenį-GA (CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGA). Bibliotekos buvo suskirstytos naudojant Genome Analyzer IIx (Illumina) Vašingtono universiteto High Throughput Genomics Unit, siekiant sukurti 36 nt ilgio vieno galo skaitymus. Skaitymai buvo suderinti su L. donovani BPK282A1 ir L. infantum JPCM5 etaloniniai genomai TriTrypDBv5.0 naudojant Bowtie2 29 .

Transporto tyrimai

Radioaktyviai pažymėto prolino ir alanino transportavimo tyrimai buvo atlikti taip, kaip aprašyta 8 skyriuje. L. donovani promastigotai buvo auginami iki logaritminės fazės, du kartus plaunami lediniu Earl’s buferiu ir koncentruojami iki 108 ląstelių/ml. Ląstelių suspensija buvo sumaišyta su reakcijos mišiniu (Earl’s buferis, 5 mM gliukozė, 10 mM Tris ir 10 mM sukcinatas) iki atitinkamo pH iki galutinio 600  tūrio. Tada ląstelės buvo iš anksto inkubuojamos 30 ଌ temperatūroje 10 min. Transportavimas buvo pradėtas sumaišius ląstelių suspensiją su nurodyta koncentracija nepažymėtų aminorūgščių ir 3 H L-aminorūgščių substratų Earl’s buferyje esant atitinkamam pH. Po 30, 60, 90, 120 ir 180 sekundžių 100 μl mišinio buvo pašalinta ir dedama tiesiai ant 24 mm GF/C stiklo mikropluošto filtrų (Whatman 1822 024). Filtrai du kartus plaunami lediniame Earl’s buferyje esant atitinkamam pH ir mirkomi scintiliaciniame skystyje. 3H įsisavinimas buvo nustatytas skysčių scintiliacijos skaičiavimu.


Chirališkumas

Visos aminorūgštys, išskyrus gliciną, yra chiralinės molekulės. Tai yra, jie egzistuoja dviejose optiškai aktyviose asimetrinėse formose (vadinamose enantiomerais), kurios yra veidrodiniai vienas kito atvaizdai. (Ši savybė konceptualiai yra panaši į erdvinį kairės rankos ir dešinės rankos santykį.) Vienas enantiomeras žymimas d, o kitas l . Svarbu pažymėti, kad baltymuose esančios aminorūgštys beveik visada turi tik l konfigūraciją. Tai atspindi faktą, kad fermentai, atsakingi už baltymų sintezę, išsivystė taip, kad panaudotų tik l-enantiomerus. Atspindint šį beveik universalumą, priešdėlis l paprastai praleidžiamas. Kai kurių d-amino rūgščių yra mikroorganizmuose, ypač bakterijų ląstelių sienelėse ir keliuose antibiotikuose. Tačiau jie nėra sintetinami ribosomoje.


Turinys

Visos aminorūgštys turi karboksilo galą (vadinamą C-galu) ir amino galą (vadinamą N-galu), tačiau jos skiriasi savo likutinėmis grupėmis. Aminorūgštys tarpusavyje sujungiamos kovalentiniu ryšiu, vadinamu peptidiniu ryšiu [6]. Aminorūgštyse yra ir karboksilo grupė (COOH), ir amino grupė (NH2). Pagrindinė aminorūgščių struktūra yra tokia:

Kur (R) yra kiekvienos skirtingos aminorūgšties šoninė grandinė. Didelės aminorūgštys sudaro standžią polipeptido stuburo sritį, o mažos aminorūgštys sudaro lanksčias polipeptido sritis, leidžiančias baltymui susilankstyti į trimatę formą. Peptidiniame pagrinde yra lankstus sukimasis aplink peptidinę jungtį ir yra standus plokščias peptidas, kurį sukelia dalinis dvigubas ryšys. Tai leidžia pirminei polipeptidų sekai susilankstyti iki alfa spiralės, kuri yra susukta viena grandine. Beta grandinė yra dvi gijos, susuktos į antilygiagrečią spiralę. Polipeptido šerdį sudaro hidrofobinės aminorūgštys, tokios kaip fenilalaninas, tirozinas ir triptofanas [8]. Šios trys aminorūgštys taip pat yra aromatinės ir yra didžiausios aminorūgštys. Kitos hidrofobinės aminorūgštys, bet nėra aromatinės, yra: prolinas, valinas, izoleucinas, leucinas ir metioninas.

Aminorūgštys vadinamos chiralinėmis, nes alfa anglis yra sujungta su keturiomis skirtingomis grupėmis. Jie gali egzistuoti kaip vienas iš dviejų veidrodinių vaizdų, vadinamų L izomeru į kairę ir D izomerą, kai baltymuose yra tik aminorūgšties izomero L forma [9].

Neutralaus pH tirpale esančios aminorūgštys daugiausia egzistuoja kaip dipoliniai jonai arba cviterionai. Dipolinėje formoje amino grupė yra protonuota, o karboksilo grupė yra deprotonuota. Aminorūgščių jonizacijos būsena kinta priklausomai nuo pH [10]. Serija aminorūgščių, sujungtų peptidiniais ryšiais, sudaro polipeptidinę grandinę, o kiekviena peptido aminorūgščių dalis vadinama liekana. Dvi aminorūgštys gali vykti kondensacijos reakcijoje, kad susidarytų dipeptidas, kartu su vandens molekulės praradimu [11].

Įprastos aminorūgštys grupuojamos pagal jų šonines grandines [12]. Pavyzdžiui, rūgštinis, bazinis, neįkrautas polinis ir nepolinis.

Bazinėse šoninėse grandinėse aminorūgštys yra: lizinas (K), argininas (R) ir histidinas (H).

Rūgščių šoninių grandinių aminorūgštys yra: asparto rūgštis (D) ir glutamo rūgštis (E) (susidaro protonui pridedant prie aminorūgščių aspartato ir glutamato).

Neįkrautų polinių šoninių grandinių aminorūgštys yra: asparaginas (N), glutaminas (Q), serinas (S), treoninas (T) ir tirozinas (Y).

Prolinas (P)

Prolinas taip pat žinomas kaip aminorūgštis. kuris dažniausiai randamas gyvuliniuose baltymuose. Jis nėra būtinas žmogaus mitybai, nes jis gali būti sintetinamas organizme iš glutamo rūgšties [13]. Skirtingai nuo kitų aminorūgščių, kurios egzistuoja polipeptidų transformacijos metu, prolinas gali egzistuoti cis formos peptiduose. Prolinas dažnai randamas α spiralės gale arba posūkiuose ar kilpose [14]. Prolinas yra vienintelė ciklinė aminorūgštis. Taip yra dėl to, kad prolinas turi keistą, ciklinę struktūrą, kai sudaro peptidinius ryšius, jis sukelia aminorūgščių grandinės lenkimą. Todėl prolinas taip pat žinomas kaip alfa spiralės laužiklis (kitas alfa spiralės laužytojas yra glicinas) [15].

Amino rūgštys vertime

Transliuojant mRNR, aminorūgštys prisijungia prie ribosomos, kai ji nuskaito mRNR ir, naudodama gautą informaciją, sukuria specifinę aminorūgščių seką, kondensacijos būdu sudarydama peptidinius ryšius tarp vienos aminorūgšties karboksilo grupės ir kitos amino grupės. reakcija. Tai sukuria polipeptidinę grandinę. 30S subvienetas pirmiausia prisijungia prie mRNR, o 50S subvienetas jungiasi antras, sudarydamas 70S iniciatoriaus kompleksą [16].

Cisteinas (C)

Aminorūgštis Cisteinas turi daug pritaikymų ir vaidina svarbų vaidmenį baltymų struktūroje. Taip yra daugiausia dėl jo tiolio grupės. Tiolis (sudarytas iš sieros ir vandenilio atomo) yra labai jautrus oksidacijai, todėl cisteinas gali sudaryti disulfidinius ryšius su kitomis molekulėmis, įskaitant kitus cisteinus. Gautas dviejų susietų cisteinų produktas vadinamas cistinu. Sujungus su kitais cisteinais, disulfidinė jungtis labai padidina baltymo stabilumą. Tačiau, kadangi tai yra oksidacijos reakcija, ji taikoma tik tarpląsteliniams baltymams, išskyrus keletą išimčių. Taip yra todėl, kad ląstelės viduje labai sumažėja, todėl disulfidinė jungtis tampa labai nestabili.

Aromatinės aminorūgštys

Aromatinės aminorūgštys yra didžiausios iš aminorūgščių ir apima fenilalaniną (F), tiroziną (Y) ir triptofaną (W). Visi jie gali sugerti ultravioletinę šviesą, tačiau kai kurie gali sugerti daugiau nei kiti, tirozinas ir triptofanas sugeria daugiau nei fenilalaninas, tai reiškia, kad triptofanas yra pagrindinė baltymo šviesą sugerianti molekulė. Aromatinės aminorūgštys taip pat yra hidrofobinės, todėl yra baltymo šerdyje, todėl jos nėra šalia vandens. Žmonės negali sintetinti fenilalanino ar triptofano, o iš fenilalanino gali gaminti tik tiroziną, o tai reiškia, kad aromatinės aminorūgštys yra gyvybiškai svarbi mūsų mitybos sudedamoji dalis, nes jų reikia tam tikruose baltymuose, bet patys jų nesintetiname. Aromatinės aminorūgštys turi aromatinį žiedą [17] . Fenilalanino trūkumas gali sukelti sumišimą, depresiją, energijos trūkumą ir sumažėjusį budrumą. Jį galima nusipirkti tablečių pavidalu, kad būtų papildytas bet koks trūkumas [18]. Nesugebėjimas suskaidyti fenilalanino pertekliaus vadinamas fenilketonurija. Siekiant kovoti su tuo, naudojama mažai fenilalanino turinčio maisto dieta, kurioje vengiama aspartamo saldiklių, kurie panašūs į fenilalaniną ir gali suskaidyti jį gaminant.


II grupė: Polinės, neįkrautos aminorūgštys

II grupės aminorūgštys yra serinas, cisteinas, treoninas, tirozinas, asparaginas ir glutaminas. Šios grupės šoninės grandinės turi funkcinių grupių spektrą. Tačiau dauguma jų turi bent vieną atomą (azoto, deguonies ar sieros) su elektronų poromis, kurios yra prieinamos vandeniliniam ryšiui su vandeniu ir kitomis molekulėmis. II grupės aminorūgščių cheminė struktūra yra tokia:

Dvi aminorūgštys, serinas ir treoninas, turi alifatines hidroksilo grupes (tai yra, deguonies atomą, susietą su vandenilio atomu, pavaizduotą kaip OH). Tirozinas aromatiniame žiede turi hidroksilo grupę, todėl jis yra fenolio darinys. Šiose trijose aminorūgštyse esančios hidroksilo grupės yra paveikiamos svarbiu posttransliaciniu modifikavimu: fosforilinimas (žr. žemiau Nestandartinės aminorūgštys). Kaip ir metioninas, cisteinas turi sieros atomą. Tačiau skirtingai nei metionino sieros atomas, cisteino siera yra labai chemiškai reaktyvi (žr. žemiau Cisteino oksidacija). Asparaginas, pirmą kartą išskirtas iš šparagų, ir glutaminas turi amido R grupės. Karbonilo grupė gali veikti kaip vandenilio jungties akceptorius, o amino grupė (NH2) gali veikti kaip vandenilio jungties donoras.


Cviterionai ir aminorūgštys

Cviterionas yra molekulė, turinti funkcines grupes, iš kurių bent viena turi teigiamą, o kita - neigiamą elektros krūvį. Visos molekulės grynasis krūvis yra lygus nuliui.

Aminorūgštys yra žinomiausi cviterionų pavyzdžiai. Juose yra amino grupė (bazinė) ir karboksilo grupė (rūgštinė). -NH2 grupė yra stipresnė bazė, todėl ji paima H + iš -COOH grupės ir palieka cviterijoną (t. y. aminų grupė deprotonuoja karboksirūgštį): 1

(Neutralus) cviterijonas yra įprasta aminorūgščių forma tirpale. Priklausomai nuo pH, yra dvi kitos formos: anijonas ir katijonas:

Tai sutampa su diprotinės rūgšties elgesiu:

su dviem disociacijos pakopomis, kontroliuojamomis dviem rūgštingumo konstantomis K1 ir K2.

Kai aminorūgštis ištirpsta vandenyje, cviterionas sąveikauja su H2O molekulės – veikiančios ir kaip rūgštis, ir kaip bazė. Tačiau, skirtingai nuo paprasto amfoterinis junginiai, kurie gali sudaryti tik katijonines arba anijonines rūšis, cviterionas vienu metu turi abi jonines būsenas.

Paprasčiausia aminorūgštis yra glicinas (NH2-CH2-COOH), kurį sutrumpiname HGly arba trumpiau HA, kai A = Gly-. Jo aukščiau parodyta struktūrinė formulė turi trumpiausią šoninę grandinę R = H. Trys rūšys yra:

[0] = [H2A + ] = [H2Gly + ] : NH3 + -CH2-COOH (glicinas katijonas)
[1] = [HA] = [HGly] : NH3 + -CH2-COO - (neutralus zwitterion)
[2] = [A - ] = [Gly - ] : NH2-CH2-COO - (glicinatas anijonas)

Dvi rūgštingumo konstantos (palyginti su anglies rūgštimi) yra šios:

glicinas: pK1 = 2.35 pK2 = 9.78
anglies rūgštis: pK1 = 6.35 pK2 = 11.33

Trijų rūšių (sutrumpintai [j]=[0], [1], [2]) priklausomybė nuo pH parodyta kaip atitinkamos jonizacijos frakcijos aj = [j]/CT:

Titravimo kreivės. Titravimo kreivės rodo, kas atsitinka glicinas kai keičiate pH, pridedant stiprios rūgšties (HCl) arba stiprios bazės (NaOH):

Kairėje diagramoje keturi sumos CT Atsižvelgiama į glicino kiekį. Skaičiavimai atliekami čia arba pdf faile pateiktomis analitinėmis formulėmis. Taškai dešinėje diagramoje yra skaitiniai skaičiavimai su aqion.

Buferio talpa ir buferio intensyvumas

Buferio talpos ir intensyvumo matematinis aprašymas yra toks pat kaip ir įprastoms rūgštims (išskyrus poslinkį Z=1). Toliau pateiktose diagramose parodyta buferio talpa (mėlyna titravimo kreivė) kartu su atitinkamu buferio intensyvumu β (žalia) ir jo išvestiniu dβ/dpH (raudona). Tai daroma dviem atvejais: be galo didelės koncentracijos glicinas ir CT = 500 mM.

Maži taškai yra dβ/dpH nuliai, kurie rodo buferio intensyvumo β kraštutinumus ir žymi titravimo kreivių vingio taškus. Mėlyna titravimo kreivė ankstesnėje kairėje diagramoje yra tokia pati kaip paskutinėje diagramoje, išskyrus tai, kad x ir y ašys yra sukeistos.

Daugiau cwitterioninių rūgščių pavyzdžių pateikiama čia.

R žymi šoninę grandinę (glicinas: R = H, alaninas: R = CH3, ir taip toliau). ↩


Amino rūgštys: samprata, klasifikacija ir reakcijos

Amino rūgštys yra baltymų statybinė medžiaga. Tarp tūkstančių gamtoje esančių aminorūgščių baltymuose yra tik 20 skirtingų aminorūgščių rūšių, visos jos yra L-alfa aminorūgštys. Tos pačios 20 standartinių aminorūgščių gamina baltymus visose gyvose ląstelėse, nesvarbu, ar tai virusas, bakterijos, mielės, augalo ar žmogaus ląstelės. Šios 20 aminorūgščių susijungia skirtingomis sekomis ir skaičiais, sudarydamos įvairių rūšių baltymus.

Baltymų, kuriuos galima gauti iš šių 20 aminorūgščių, skaičių galima apskaičiuoti iš 20 faktorių, ty 20 x 19 x 18 x 17 x 16 x ………… x 2 x 1 = 2,4 x 10 18 . Vien žmogaus organizme yra daugiau nei 100 000 skirtingų rūšių baltymų.

Bendrosios aminorūgšties formulės gali būti parašytos kaip ‘R-CH-NH2—COOH’. Priklausomai nuo ‘R’ grupės, esančios aminorūgštyje, ji atitinkamai pavadinta. 20 aminorūgščių, esančių baltymuose, yra žinomos kaip pirminės arba standartinės aminorūgštys. Be šių, kai kurių kitų aminorūgščių taip pat yra baltymuose, tokiuose kaip 4-hidroksiprolinas, 5-hidroksilizinas, 6-IV-metilizinas, gama karboksiglutamo rūgštis ir desmozinas. Visos šios yra standartinių aminorūgščių dariniai.

Aminorūgščių klasifikacija:

I. Priklausomai nuo mokesčio:

Aminorūgštys gali būti suskirstytos į tris pagrindines grupes:

1. Neutralios aminorūgštys:

Tos aminorūgštys, kuriose nėra jokio krūvio ‘R’ grupėje.

Jie toliau skirstomi į šias kategorijas:

Tos aminorūgštys, kurių ‘R’ grupėje yra anglies atomų grandinė – Gly, Ala, Ser, Thr, Val, Leu, lie, Asn, Gin.

Tos aminorūgštys, kurių ‘R’ grupė turi benzeno žiedą – Phe, Tyr, Trp.

“R” grupė turi heterociklinį žiedą, ty bet kurią žiedo struktūrą, kurioje yra skirtingi atomai – Pro, His.

d) Sieros sudėtyje yra:

Tos aminorūgštys, kuriose yra sieros atomas – Cys, Met.

Tos aminorūgštys, kuriose yra neigiamas krūvis arba rūgštinė grupė – Asp, Glu.

Tos aminorūgštys, kuriose yra teigiamas krūvis arba bazinė grupė – Arg, Lys ir His.

II. Priklausomai nuo tirpumo vandenyje:

Aminorūgštys taip pat gali būti suskirstytos į dvi skirtingas kategorijas, atsižvelgiant į jų tirpumą vandenyje. Jie yra-

1. Hidrofobinės aminorūgštys:

Vandenyje netirpios aminorūgštys yra žinomos kaip hidrofobinės aminorūgštys. Jie yra - Ala, Val, Leu, lie, Pro, Met, Phe, Trp.

2. Hidrofilinės aminorūgštys:

Vandenyje tirpios aminorūgštys yra žinomos kaip hidrofilinės aminorūgštys. Jie yra Gly, Ser, Thr, Cys, Tyr, Asp, Asn, Glu, Gin, Lys, Arg, His.

III. Priklausomai nuo jų mitybos poreikių:

Aminorūgštys skirstomos į dvi grupes.

1. Nepakeičiamos aminorūgštys:

Tai yra tie, kurių žmogaus organizmas negali susintetinti, todėl juos reikia vartoti su maistu. Yra 10 nepakeičiamų aminorūgščių. Tarp šių aminorūgščių argininas ir histidinas yra žinomi kaip pusiau nepakeičiamos aminorūgštys.

2. Neesminės aminorūgštys:

Šios rūgštys yra tos, kurios gali būti susintetintos žmogaus organizme ir nėra būtinos su maistu. Tai yra gly, ala, ser, pro, tyr, cys, asp, asn, glu, gin.

Amino rūgščių reakcijos:

Aminorūgščių fizinės savybės:

Aminorūgštys turi rūgštinę grupę (-COOH grupę), ty protoną, donorą. Jie taip pat turi pagrindinę grupę (-NH2 grupė), ty protonas, akceptorius. Junginys, galintis tiek dovanoti, tiek priimti protonus, todėl gali veikti kaip rūgštis arba bazė, žinomas kaip amfoterinė molekulė. Aminorūgščių tirpale yra ir anijonų, ir katijonų, o tokie junginiai vadinami zwitter jonais.

2. Izoelektrinis pH (pH 1):

pH, kai teigiamas aminorūgšties (ar bet kurios kitos molekulės) krūvis yra lygus neigiamiems krūviams, yra žinomas kaip izoelektrinis pH. Esant tokiam pH grynasis krūvis bus lygus nuliui, todėl veikiamas elektrinio lauko jis nejuda nei į teigiamą (anodo), nei į neigiamą (katodą) elektrodą. Esant pH 1, visos molekulės egzistuoja zwitter jonų pavidalu.

Cheminės savybės:

1. Reakcijos dėl amino grupės:

Šis testas identifikuoja arba aptinka aminorūgštis. Kai aminorūgštys kaitinamos ninhidrinu, susidaro purpurinės mėlynos spalvos junginys, kuris matuojamas kolorimetriškai.

b) Reakcija su azoto rūgštimi:

Tai metodas, kuriuo aminorūgštys matuojamos priklausomai nuo išsiskiriančio azoto kiekio.

c) Reakcija su karbonilo junginiais (RCHO):

Aminorūgščių amino grupė reaguoja su karbonilo junginiais, sudarydama Šifo bazę.

(d) Reakcija su Sangerio reagentu:

Aminorūgštys reaguoja su Sanger’s reagentu, ty 1-fluor-2,4-dinitrobenzenu, sudarydamos geltonos spalvos kompleksą. Šis reagentas naudojamas aptikti IV galinę aminorūgštį baltymuose.

Edmann’s reagentas yra fenilizotiocianatas, kuris taip pat naudojamas aptikti N-galinę aminorūgštį baltyme. Jis sudaro purpurinės spalvos darinį.

f) Reakcija su danzilo chloridu:

Dansilo chloridas, ty 1-dimetil-amino-naftalen-5-sulfonilchloridas, sudaro baltymų N-galinės aminorūgšties fluorescencinį darinį. Tai dar vienas reagentas, skirtas aptikti N-galinę aminorūgštį.

g) Dviejų aminorūgščių kondensacija, kad susidarytų diketopiperazinas:

Dvi aminorūgštys reaguoja su kiekvienos aminorūgšties amino grupėmis ir kitos aminorūgšties karboksilo grupėmis, sudarydamos diketopiperaziną.

2. Reakcija dėl karboksilo:

a) Reakcija su hidrazinu:

Hydrazine is used to detect the C-terminal amino acid in proteins. It forms a complex with the amino acid by reacting with the carboxylic group.

3. Reaction due to both amino and carboxylic group:

Due to the presence of both amino (basic) and carboxylic (acid) groups in amino acids, the amino group of one amino acid reacts with the carboxylic group of another amino acid to form a peptide bond.

Polymerization of amino acids in a similar manner gives a polypeptide chain.

The bond linking two amino acids is known as a peptide bond. It is formed due to reaction between an amino group of one amino acid and carboxylic group of another amino acid.

The group forming the peptide bond is known as peptide group. It has a double bond character and hence is very rigid in nature.

Polypeptide or peptide:

A chain made up of two or more amino acids, linked by a peptide bond is known as a polypeptide or just a peptide.

Difference between a peptide and a protein:

A peptide is that which has less than 50 amino acids or whose molecular weight is less than 5000 Daltons. A protein is that which has more than 50 amino acids or whose molecular weight is more than 5000 Daltons. This differentiation is based upon the immunolog­ical property of the two units. Peptides are non-immunogenic, whereas proteins are immunogenic.

N-terminal and C-terminal of a protein:

The end of a protein or polypeptide where the amino group is free in known as N-terminal end and that amino acid whose amino group is free is known as N-terminal amino acid. Sanger’s, Edmann’s and Dansyl chloride are the reagents used to determine the N-terminal amino acids.

The end of the protein or polypeptide whose carboxylic group is free is known as C-terminal end and that amino acid whose carboxylic group is free in the protein is known as C-terminal amino acid. Hydrazine is used to detect the C-terminal amino acid. While representing a protein on paper, the N-terminal amino acid is written first (on the left) and the C-terminal amino acid is the last one (written at the right side of the paper).

Peptides of physiological importance:

It is a tripeptide made up of Glu, Cys and Gly. It is found in RBC and other tissues and functions to prevent oxidation of —SH groups of many enzymes.

b) Bradykinin and kallidin:

These are small polypeptides containing 9 and 10 amino acids respectively. They are formed by partial hydrolysis of plasma protein due to snake poisoning (venom). They are powerful vasodepressors and inhibitors of heart function. Others are tyrocidin, gramicidin, glucagon, insulin, oxytocin, etc.

The structure of protein can be studied under four different levels of organization, viz., primary, secondary, tertiary and quaternary.