Informacija

Trumpesnių telomerų ryšys su širdies liga

Trumpesnių telomerų ryšys su širdies liga


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Iš šio popieriaus

Tų, kurių kraujo DNR telomerai buvo trumpesni, išgyvenamumas buvo mažesnis, iš dalies dėl 3,18 karto didesnio mirtingumo nuo širdies ligų (95 % PI 1(.)36-7,45, p=0,0079) ir 8,54 karto didesniu mirtingumu. nuo infekcinės ligos (1,52-47,9, p=0,015).

Koks ryšys tarp trumpesnių telomerų ir širdies ligų?


Tai atrodo kaip vištos ir kiaušinio problema. Telomerų ilgis yra susijęs ir su amžiumi, ir su širdies ligomis, tačiau širdies ligos taip pat yra susijusios su amžiumi. Kyla klausimas, ar tikrai vienas sukelia kitą (trumpų telomerų širdies problemos), ar jos atsiranda vienu metu? Kita problema, susijusi su širdies ligomis, yra ta, kad tai yra daugelio rizikos rūšių liga, kurios rizika didėja su amžiumi. Žemiau pateiktame paveikslėlyje tai apibendrinama, ji yra iš pirmojo dokumento:

Pažvelkite į šiuos straipsnius:


Asociacija tarp genetinių variacijų, turinčių įtakos vidutiniam telomero ilgiui ir hipertenzijos bei koronarinės širdies ligos paplitimui korėjiečiams

Šiame tyrime mes ištyrėme, ar vieno nukleotido polimorfizmai (SNP), susiję su telomero ilgiu (TL), buvo susiję su hipertenzijos (HTN) / koronarinės širdies ligos (CHD) ir širdies ir kraujagyslių rizikos veiksniais Korėjos populiacijoje. Buvo ištirti 5705 (39–70 metų amžiaus) Korėjos genomo epidemiologijos tyrimo dalyvių (Ansung kaimo ir miesto Ansan kohortos) duomenys. Buvo išbandyta dvylika SNP, susijusių su telomerų biologija, siekiant nustatyti ryšį su HTN / CHD. Dėl to reikšmingų sąsajų tarp pasirinktų su TL susijusių SNP ir HTN bei CHD paplitimo nerasta. Alkoholio nevartojantys asmenys, turintys nedidelius alelius rs1269304 ir rs10936601 (TERC ir LRRC34, atitinkamai) pasireiškė didesnis ŠKL pasireiškimo dažnis (šansų santykis [OR], 1,862 95 % pasikliautinieji intervalai [CIs], 1,137, 3,049 OR, 1,855 95 % CI, atitinkamai 1,111, 2,985). Tačiau alkoholio vartotojai, turintys nedidelių alelių rs398652 (PELI2) buvo reikšmingai susiję su didesniu HTN paplitimu (OR, 1,179 95 % PI, 1,040, 1,336). Iš 3 SNP, susijusių su ligos baigtimi, rs1296304 buvo reikšmingai susijęs su padidėjusiu diastolinio kraujospūdžio lygiu (β įvertinimas, 0,470 95 % PI, 0,013, 0,926). Mažasis rs398652 alelis buvo reikšmingai susijęs su didesniu kūno masės indeksu (OR, 0,128 95 % CIs, 0,010, 0,246) ir γ-glutamilo transpeptidaze (OR, 0,013 95 % CIs, 0,001, 0,024). Apibendrinant galima pasakyti, kad nebuvo reikšmingų sąsajų tarp pasirinktų su TL susijusių SNP ir HTN / CHD atsiradimo korėjiečiams. Tačiau rezultatai rodo, kad gali būti sąveika tarp susijusių SNP ir alkoholio elgesio, susijusio su HTN / CHD atsiradimu.

Raktiniai žodžiai: Koronarinė širdies liga Genetiniai variantai Hipertenzija Korėjos genomo epidemiologijos tyrimas Telomero ilgis.

Interesų konflikto pareiškimas

Autoriai pareiškia, kad neturi konkuruojančių interesų.

Figūros

Ryšys tarp ligų paplitimo ir…

Ryšys tarp ligų paplitimo ir su telomeru susijusių genotipų pagal alkoholio būklę. The…


Sergančios širdies raumens ląstelės turi neįprastai sutrumpėjusius telomerus

Stanfordo mokslininkai nustatė, kad pacientams, sergantiems kardiomiopatija, ląstelėse, atsakingose ​​už širdies susitraukimą, yra neįprastai trumpi telomerai. Šis ligos požymis atveria naujus kelius vaistų atradimui.

Remiantis nauju Stanfordo universiteto medicinos mokyklos mokslininkų tyrimu, žmonės, sergantys širdies liga, vadinama kardiomiopatija, turi neįprastai trumpus širdies raumens ląstelių telomerus, atsakingus už susitraukimą.

Telomeras yra DNR seka, kuri tarnauja kaip apsauginis dangtelis ant chromosomų galų.

Išvada sutampa su ankstesniu tyrimu, rodančiu, kad žmonių, sergančių Diušeno raumenų distrofija, genetine raumenų nykimo liga, širdies raumens ląstelėse arba kardiomiocituose taip pat yra trumpų telomerų. Šie pacientai dažnai miršta ankstyvame amžiuje nuo širdies nepakankamumo.

Nors dar nežinoma, ar sustingę telomerai tiesiogiai veikia kardiomiocitų funkciją, ar atsiranda dėl širdies nepakankamumo, šis atradimas atveria duris į intriguojančią tyrimų ir vaistų atradimo kryptį. Taip pat vieną dieną mokslininkai ir gydytojai galės nustatyti žmones, kuriems gresia širdies nepakankamumas dėl kardiomiopatijos.

„Atrodo, kad telomerų sutrumpėjimas kardiomiocituose yra patikimas širdies nepakankamumo, atsirandančio dėl genetinių defektų, požymis, ir tai labai būdinga ląstelėms, kurioms, be kita ko, reikia trūkstamų susitraukiančių baltymų, tokių kaip distrofinas, troponinas T arba miozino sunkioji grandinė. sakė Helen Blau, PhD, mikrobiologijos ir imunologijos profesorė bei Stanfordo širdies ir kraujagyslių instituto narė.

Blau, Donaldo E. ir Delia B. Baxter fondo profesorius ir Baxter kamieninių ląstelių biologijos laboratorijos direktorius, yra tyrimo, kuris buvo paskelbtas internete rugpjūčio 27 d. Nacionalinės mokslų akademijos darbai. Alex Chang, PhD, širdies ir kraujagyslių medicinos bei mikrobiologijos ir imunologijos instruktorius, yra pagrindinis autorius.

Sutrumpinimas su ląstelių dalijimusi

Daugumoje ląstelių telomerai natūraliai trumpėja kiekvieną kartą, kai ląstelė dalijasi. Tačiau kardiomiocitai dalijasi retai, o jų telomerų ilgis išlieka gana stabilus visą gyvenimą.

Žmonėms Diušeno raumenų distrofijai, kurią sukelia distrofino geno mutacija, būdingas progresuojantis raumenų silpnumas ir galiausiai mirtis dėl širdies komplikacijų. Ankstesniame darbe Blau ir jos kolegos pastebėjo, kad nors pelėms su atitinkama distrofino mutacija pasireiškė raumenų išsekimo simptomai, jų širdys veikė normaliai. Tyrėjai suprato, kad pagrindinis skirtumas tarp žmonių ir pelių yra kiekvienos rūšies telomerų ilgis: žmogaus telomerai yra santykinai trumpi – 5–15 kilobazių, tačiau pelių telomerai artėja prie 40 kilobazių. Kai tyrėjai įvedė antrąją pelių mutaciją, kuri sumažino telomerų ilgį, kad labiau atitiktų žmonių, gyvūnams pasireiškė tipiški ligos simptomai, įskaitant širdies nepakankamumą.

Vėlesnis tyrimas Blau laboratorijoje parodė, kad pelėms telomerų sutrumpėjimas sukėlė DNR pažeidimo reakciją, kuri pakenkė ląstelių energijos generatorių arba mitochondrijų funkcijai. Dėl to kardiomiocitai negalėjo efektyviai pumpuoti kraujo visame kūne.

„Kadangi ankstesniame tyrime nustatėme, kad berniukų, mirusių nuo Diušeno raumenų distrofijos, kardiomiocitų telomerai buvo maždaug 50 procentų trumpesni nei asmenų, nesergančių šia liga“, – sakė Blau, „mes pasidomėjome, ar žmonės, turintys kitų genetinių širdies ligų, pavyzdžiui, kardiomiopatijos, taip pat gali turėti kardiomiocitų su nenormaliai sutrumpėjusiais telomerais. Blau ir Chang bendradarbiavo su keliais kitais Stanfordo širdies ir kraujagyslių instituto nariais, kad ištirtų šį klausimą.

Kardiomiopatija yra būklė, kai širdis yra neįprastai didelė, sustorėjusi arba sustingusi. Tai turi įtakos jo gebėjimui efektyviai pumpuoti kraują. Pasaulyje serga vienas iš 500–2500 žmonių, o kardiomiopatijos yra pagrindinė širdies persodinimo priežastis. Išsiplėtusi kardiomiopatija atsiranda, kai padidėja kairysis skilvelis, o hipertrofinę kardiomiopatiją sukelia širdies raumens sustorėjimas.

Naudojant iPS ląsteles

Chang palygino telomero ilgį kardiomiocituose iš 11 pacientų, sergančių išsiplėtusia ar hipertrofine kardiomiopatija dėl genetinių mutacijų, su devyniais žmonėmis, kurie mirė dėl priežasčių, nesusijusių su širdies liga. Jis nustatė, kad kardiomiopatija sergančių pacientų telomerai buvo maždaug 25–40 procentų trumpesni nei kontrolinių asmenų. Priešingai, telomerų ilgis neplakančiose kraujagyslių širdies ląstelėse reikšmingai nesiskyrė tarp dviejų grupių.

Changas pastebėjo panašius rezultatus kardiomiocituose, sukurtuose iš indukuotų pluripotentinių kamieninių ląstelių: tų, kurie buvo sukurti iš žmonių, sergančių kardiomiopatija, turėjo žymiai trumpesnius telomerus nei tie, kurie buvo sukurti iš nepakitusių giminaičių.

„Per 20 dienų galėjome pastebėti telomerų sutrumpėjimą sergančių pacientų laboratorijoje išaugintuose kardiomiocituose, o tai rodo, kad tai būdinga ląstelėms“, – sakė Blau.

Galimybė naudoti iPS ląstelių technologiją paveiktiems kardiomiocitams generuoti taip pat reiškia, kad turėtų būti įmanoma greitai ir lengvai ištirti junginius ar vaistus, kurie trukdo telomerų trumpėjimui, siekiant rasti vaistų, kurie panaikintų žmonių ligą, mano mokslininkai.

„Dabar galime tyrinėti šį reiškinį laboratorijoje realiu laiku ir pradėti užduoti klausimus apie priežastį ir pasekmes“, – sakė Blau. "Mes norėtume žinoti, pavyzdžiui, kaip šis sutrumpinimas gali paveikti DNR pažeidimo reakciją, mitochondrijų disfunkciją ir ląstelių mirties kelius. Tai atveria visiškai naują tyrimo kryptį.

Kiti Stanfordo tyrimo autoriai yra klinikinis instruktorius Andrew Changas, medicinos mokslų daktaras, buvęs mokslinis stažuotojas Koki Sasagawa ir Willis Su klinikinis bendradarbis Gerhardas Weberis, medicinos mokslų daktaras, daktaras Vittavat Termglinchanas, širdies ir krūtinės chirurgijos docentas Ioannis Karakikesas, doktorantas Timonas Seegeris, medicinos mokslų daktaras. studentė Alexandra Dainis neurologijos ir pediatrijos profesorius John Day, MD, širdies ir kraujagyslių medicinos mokslų daktaras Euanas Ashley, MD, mokslų daktaras ir širdies ir kraujagyslių medicinos bei radiologijos profesorius Joseph Wu, MD, PhD.

Prie tyrimo prisidėjo ir mokslininkai iš Kalifornijos universiteto San Franciske, Džeksono laboratorijos ir Harvardo medicinos mokyklos.

Tyrimą palaikė Nacionaliniai sveikatos institutai (subsidijos AG044815, AR063963, HL104002, HL125807, HL126527, HL130020, HL123968 ir HL117756), Amerikos širdies asociacija, Stanfordo Stanfordo medicinos institutas, Canadso medicinos institutas. Širdies ir kraujagyslių institutas, Nacionalinis mokslo fondas, Stanfordo-Coulterio vertimo tyrimų stipendijų programa, Burroughs Wellcome fondas, Howardo Hugheso medicinos institutas ir Baxter fondas.


Studijų planas ir rezultatai

Tyrimo metu mokslininkai išmatavo grupės rasinį šališkumą, naudodami testą, kuris įvertina nesąmoningas rasines nuostatas pagal greitį, kuriuo dalyvis suderina veido atvaizdus su žodžiais, turinčiais teigiamą ir neigiamą konotaciją. Asmeninė diskriminacijos patirtis buvo nustatyta naudojant klausimyną. Telomerų ilgis buvo matuojamas iš džiovinto kraujo dėmės mėginio.

Tyrėjai nustatė, kad individualiai nei diskriminacija, nei rasinis šališkumas neturėjo aiškios sąsajos su litais. Veikiau reikšmingas buvo dviejų veiksnių derinys arba sąveika.

„Pastebėjome, kad tie dalyviai, kurie įsisavina neigiamą rasinės grupės požiūrį – turi priešiškumą juodaodžiui – gali būti labiau linkę suvokti, kad nusipelno diskriminacijos ir turi trumpesnius telomerus“, – sakė daktaras Chae. „Atrodo, kad tie, kurie teigiamai vertina savo rasę – turi juodaodžių šališkumą – yra tam tikru būdu apsaugoti“.

Tyrėjai pastebėjo keletą savo tyrimo apribojimų. Reikia daugiau tyrimų, siekiant paaiškinti ryšį tarp šališkumo, diskriminacijos ir telomero ilgio. Be to, išvadų apibendrinimas yra ribotas, atsižvelgiant į mažą tyrimo grupę.

„Nepaisant įspėjimų, šis tyrimas palaiko perspektyvią matavimo ir tyrimų kryptį, siekiant geriau suprasti sveikatos skirtumus, šiuo atveju afroamerikiečių vyrų“, – sakė NIA Specialiųjų gyventojų biuro direktorius dr. Carlas V. Hillas. "Šis požiūris, kuris atsižvelgia į psichosocialinius veiksnius ir yra pagrįstas pagrindine senėjimo biologija, yra labai įdomus."


Telomerai yra trumpesni pacientams, sergantiems miokardo infarktu, palyginti su sveikaisiais: koreliacija su aplinkos rizikos veiksniais

Buvo pranešta apie trumpesnius telomerus pacientams, sergantiems priešlaikiniu miokardo infarktu (MI). Mūsų darbu buvo siekiama patvirtinti trumpesnio telomero ryšį su MI dviejuose atvejų kontrolės tyrimuose ir šeiminės hipercholesterolemija (FH) sergantiems pacientams, sergantiems koronarine širdies liga (CHD). HIFMECH tyrime buvo lyginami 598 baltaodžiai vyrai (<60 metų), kurie išgyveno pirmąjį MI, ir 653 pagal amžių atitinkantys kontroliniai pacientai iš Šiaurės ir Pietų Europos. Be to, iš JK buvo įdarbinti 413 pacientų, kuriems atlikta vainikinių arterijų šuntavimo operacija (CABG), ir dvi grupės iš 367 ir 94 FH pacientų, iš kurių atitinkamai 145 ir 17 sirgo priešlaikine ŠKL. Leukocitų telomerų ilgis (LTL) buvo matuojamas naudojant realaus laiko polimerazės grandininės reakcijos metodą. HIFMECH tyrimo metu litai buvo žymiai trumpesni tiriamiesiems iš šiaurės (7,99 kb, SD 4,51), palyginti su pietine (8,27 kb, SD 4,14 p = 0,02), ir atvejais (7,85 kb, SD 4,01), palyginti su kontrolinėmis grupėmis (8,04 kb, SD 4,46 p = 0,04). CABG tyrime Lt buvo žymiai trumpesnis (6,89 kb, SD 4,14), lyginant su HIFMECH UK kontrolinėmis grupėmis (7,53, SD 5,29 p = 0,007). Abiejose FH pacientų imtyse Lt buvo trumpesnis pacientams, sergantiems ŠKL (bendras 8,68 kb, SD 4,65), palyginti su nesergančiais ŠKL (9,23 kb, SD 4,83 p = 0,012). Išskyrus nuoseklią neigiamą koreliaciją su amžiumi, Lt nebuvo siejama visuose tyrimuose su jokiais išmatuotais ŠKL rizikos veiksniais. Šie duomenys patvirtina, kad subjektai, sergantys ŠKL, turi trumpesnius telomerus nei kontroliniai, ir tai išplečiama tiems, kuriems yra monogeninės ir poligeninės ŠKL formos.

Figūros

Telomerų ilgio sumažėjimas su…

Su amžiumi mažėja telomerų ilgis. Telomero ilgis pavaizduotas loge T/S…

Leukocitų telomerų ilgio palyginimas…

Leukocitų telomero ilgio (kilobaitai) palyginimas tarp šiaurės ir pietų HIFMECH tyrime.…

Telomerų ilgio palyginimas tarp…

Telomerų ilgio palyginimas tarp atvejų ir kontrolinių elementų. Geometrinis telomero ilgio vidurkis…

Ryšys tarp telomerų ilgio ir…

Koreliacija tarp telomero ilgio ir statinų vartojimo trukmės FH sergantiems pacientams. Telomeras…


Sergančių širdies raumenų ląstelės turi neįprastai sutrumpėjusius telomerus

Remiantis nauju Stanfordo universiteto medicinos mokyklos mokslininkų tyrimu, žmonės, sergantys širdies liga, vadinama kardiomiopatija, turi neįprastai trumpus širdies raumens ląstelių telomerus, atsakingus už susitraukimą.

Telomeras yra DNR seka, kuri tarnauja kaip apsauginis dangtelis ant chromosomų galų.

Išvada sutampa su ankstesniu tyrimu, rodančiu, kad žmonių, sergančių Diušeno raumenų distrofija, genetine raumenų nykimo liga, širdies raumens ląstelėse arba kardiomiocituose taip pat yra trumpų telomerų. Šie pacientai dažnai miršta ankstyvame amžiuje nuo širdies nepakankamumo.

Nors dar nežinoma, ar sustingę telomerai tiesiogiai veikia kardiomiocitų funkciją, ar atsiranda dėl širdies nepakankamumo, šis atradimas atveria duris į intriguojančią tyrimų ir vaistų atradimo kryptį. Taip pat vieną dieną mokslininkai ir gydytojai galės nustatyti žmones, kuriems gresia širdies nepakankamumas dėl kardiomiopatijos.

„Atrodo, kad telomerų sutrumpėjimas kardiomiocituose yra patikimas širdies nepakankamumo, atsirandančio dėl genetinių defektų, požymis, ir tai labai būdinga ląstelėms, kurioms, be kita ko, reikia trūkstamų susitraukiančių baltymų, tokių kaip distrofinas, troponinas T arba miozino sunkioji grandinė. sakė Helen Blau, PhD, mikrobiologijos ir imunologijos profesorė bei Stanfordo širdies ir kraujagyslių instituto narė.

Blau, Donaldo E. ir Delia B. Baxter fondo profesorius ir Baxter kamieninių ląstelių biologijos laboratorijos direktorius, yra tyrimo, kuris buvo paskelbtas internete rugpjūčio 27 d. Nacionalinės mokslų akademijos darbai. Alex Chang, PhD, širdies ir kraujagyslių medicinos bei mikrobiologijos ir imunologijos instruktorius, yra pagrindinis autorius.

Sutrumpinimas su ląstelių dalijimusi

Daugumoje ląstelių telomerai natūraliai trumpėja kiekvieną kartą, kai ląstelė dalijasi. Tačiau kardiomiocitai dalijasi retai, o jų telomerų ilgis išlieka gana stabilus visą gyvenimą.

Žmonėms Diušeno raumenų distrofijai, kurią sukelia distrofino geno mutacija, būdingas progresuojantis raumenų silpnumas ir galiausiai mirtis dėl širdies komplikacijų. Ankstesniame darbe Blau ir jos kolegos pastebėjo, kad nors pelėms su atitinkama distrofino mutacija pasireiškė raumenų išsekimo simptomai, jų širdys veikė normaliai. Tyrėjai suprato, kad pagrindinis skirtumas tarp žmonių ir pelių yra kiekvienos rūšies telomerų ilgis: žmogaus telomerai yra santykinai trumpi – 5–15 kilobazių, tačiau pelių telomerai artėja prie 40 kilobazių. Kai tyrėjai įvedė antrąją pelių mutaciją, kuri sumažino telomerų ilgį, kad labiau atitiktų žmonių, gyvūnams pasireiškė tipiški ligos simptomai, įskaitant širdies nepakankamumą.

Vėlesnis tyrimas Blau laboratorijoje parodė, kad pelėms telomerų sutrumpėjimas sukėlė DNR pažeidimo reakciją, kuri pakenkė ląstelių energijos generatorių arba mitochondrijų funkcijai. Dėl to kardiomiocitai negalėjo efektyviai pumpuoti kraujo visame kūne.

„Kadangi ankstesniame tyrime nustatėme, kad berniukų, mirusių nuo Diušeno raumenų distrofijos, kardiomiocitų telomerai buvo maždaug 50 procentų trumpesni nei asmenų, nesergančių šia liga“, – sakė Blau, „mes pasidomėjome, ar žmonės, turintys kitų genetinių širdies ligų, pavyzdžiui, kardiomiopatijos, taip pat gali turėti kardiomiocitų su nenormaliai sutrumpėjusiais telomerais. Blau ir Chang bendradarbiavo su keliais kitais Stanfordo širdies ir kraujagyslių instituto nariais, kad ištirtų šį klausimą.

Kardiomiopatija yra būklė, kai širdis yra neįprastai didelė, sustorėjusi arba sustingusi. Tai turi įtakos jo gebėjimui efektyviai pumpuoti kraują. Pasaulyje serga vienas iš 500–2500 žmonių, o kardiomiopatijos yra pagrindinė širdies persodinimo priežastis. Išsiplėtusi kardiomiopatija atsiranda, kai padidėja kairysis skilvelis, o hipertrofinę kardiomiopatiją sukelia širdies raumens sustorėjimas.

Naudojant iPS ląsteles

Chang palygino telomerų ilgį kardiomiocituose iš 11 pacientų, sergančių išsiplėtusia ar hipertrofine kardiomiopatija dėl genetinių mutacijų, su devyniais žmonėmis, kurie mirė dėl priežasčių, nesusijusių su širdies liga. Jis nustatė, kad kardiomiopatija sergančių pacientų telomerai buvo maždaug 25–40 procentų trumpesni nei kontrolinių asmenų. Priešingai, telomerų ilgis neplakančiose kraujagyslių širdies ląstelėse reikšmingai nesiskyrė tarp dviejų grupių.

Changas pastebėjo panašius rezultatus kardiomiocituose, sukurtuose iš indukuotų pluripotentinių kamieninių ląstelių: tų, kurie buvo sukurti iš žmonių, sergančių kardiomiopatija, turėjo žymiai trumpesnius telomerus nei tie, kurie buvo sukurti iš nepakitusių giminaičių.

„Per 20 dienų galėjome pastebėti telomerų sutrumpėjimą sergančių pacientų laboratorijoje išaugintuose kardiomiocituose, o tai rodo, kad tai yra ląstelėms būdinga savybė“, - sakė Blau.

Galimybė naudoti iPS ląstelių technologiją paveiktiems kardiomiocitams generuoti taip pat reiškia, kad turėtų būti įmanoma greitai ir lengvai ištirti junginius ar vaistus, kurie trukdo telomerų trumpėjimui, siekiant rasti vaistų, kurie panaikintų žmonių ligą, mano mokslininkai.

„Dabar galime tyrinėti šį reiškinį laboratorijoje realiu laiku ir pradėti užduoti klausimus apie priežastį ir pasekmes“, – sakė Blau. "Mes norėtume žinoti, pavyzdžiui, kaip šis sutrumpinimas gali paveikti DNR pažeidimo reakciją, mitochondrijų disfunkciją ir ląstelių mirties kelius. Tai atveria visiškai naują tyrimo kryptį.

Kiti Stanfordo tyrimo autoriai yra klinikinis instruktorius Andrew Changas, medicinos mokslų daktaras, buvęs mokslinis stažuotojas Koki Sasagawa ir Willis Su klinikinis bendradarbis Gerhardas Weberis, medicinos mokslų daktaras, daktaras Vittavat Termglinchanas, širdies ir krūtinės chirurgijos docentas Ioannis Karakikesas, doktorantas Timonas Seegeris, medicinos mokslų daktaras. studentė Alexandra Dainis neurologijos ir pediatrijos profesorius John Day, MD, širdies ir kraujagyslių medicinos mokslų daktaras Euanas Ashley, MD, mokslų daktaras ir širdies ir kraujagyslių medicinos bei radiologijos profesorius Joseph Wu, MD, PhD.

Prie tyrimo prisidėjo ir mokslininkai iš Kalifornijos universiteto San Franciske, Džeksono laboratorijos ir Harvardo medicinos mokyklos.

Tyrimą palaikė Nacionaliniai sveikatos institutai (subsidijos AG044815, AR063963, HL104002, HL125807, HL126527, HL130020, HL123968 ir HL117756), Amerikos širdies asociacija, Stananfordo Stanfordo medicinos institutas, Canads of Health Felloweship. Širdies ir kraujagyslių institutas, Nacionalinis mokslo fondas, Stanfordo-Coulterio vertimo tyrimų stipendijų programa, Burroughs Wellcome fondas, Howardo Hugheso medicinos institutas ir Baxter fondas.

Sergančių širdies raumenų ląstelės turi neįprastai sutrumpėjusius telomerus iš pradžių buvo paskelbta Stanfordo universiteto svetainėje.


Trumpesnio vidutinio telomero ilgio ir didelių arterijų standumo ryšys pacientams, sergantiems koronarine širdies liga

Fonas: Besikaupiantys įrodymai rodo, kad leukocitų telomero ilgis (LTL) sutrumpėja kaip galimas širdies ir kraujagyslių ligų rizikos veiksnys. Arterijų sustingimas rodo bendrą širdies ir kraujagyslių ligų rizikos veiksnių naštą. Todėl buvo ištirtas Lt gebėjimas numatyti arterijų standumą.

Metodai: Iš viso į šį tyrimą buvo įtraukti 275 nesusiję Kinijos vyrai: 163 pacientai, sergantys vainikinių arterijų liga (CAD) ir 112 sveikų kontrolinių asmenų, 40–73 metų amžiaus. Santykinis leukocitų telomero ilgis buvo nustatytas realaus laiko fluorescencine kiekybine polimerazės grandinine reakcija (PGR). Didžiųjų arterijų standumas buvo matuojamas miego ir šlaunikaulio pulso bangos greičiu (PWV).

Rezultatai: Santykinis telomerų ilgio (T/S) santykis pacientams, sergantiems ŠKL, buvo reikšmingai trumpesnis (0,79 +/- 0,26) nei kontrolinių asmenų (1,08 +/- 0,22) (p<0,001). Koreliacija tarp LTL ir PWV pacientų, sergančių ŠKL, buvo stipresnė nei kontrolinės grupės (r= -0,467, r(2)=0,227, p<0,001 pacientams, sergantiems ŠKL, palyginti su r= -0,223 r(2)=0,050 p= 0,018 valdikliams). Log(e) transformuotas T/S santykis buvo atvirkščiai koreliuojamas su amžiumi (r= -0,345 p<0,001), PWV (r= -0,326 p<0,001) ir C reaktyviuoju baltymu (r= -0,133 p=0,027). .

Išvados: Duomenys rodo leukocitų telomero ilgio sutrumpėjimo ryšį su padidėjusiu arterijų standumu ir širdies ir kraujagyslių našta, o tai rodo, kad telomero ilgis yra didelių arterijų elastingumo ir CAD biomarkeris. Norint ištirti LTL dinamikos vaidmenį aterosklerozės patogenezėje, būtina atlikti tolesnius tyrimus.


Medžiagos ir metodai

Studiju dizainas

Skelbimu įdarbinome 450 tiriamųjų, kurie nuo 2012 m. gegužės iki 2012 m. gruodžio mėn. lankėsi Nacionaliniame prevencinės medicinos tyrimų centre Maskvoje, Rusijoje. Norėdami nustatyti tinkamumą, tiriamieji atliko sveikatos patikrinimą, kuris apėmė ligos istoriją, fizinę apžiūrą ir kraujo mėginių paėmimą. laboratoriniams tyrimams. Mes neįtraukėme 147 tiriamųjų, kurie anksčiau vartojo vaistus nuo diabeto, hipertenzijos ar hiperlipidemijos, sirgo insultu, koronarine širdies liga, periferinių arterijų liga, aritmija, staziniu širdies nepakankamumu arba vožtuvų širdies liga, kepenų ar inkstų nepakankamumu, taip pat vėžiu. Po šių išskyrimų į tyrimą buvo įtraukti 303 tiriamieji.

Tyrimą patvirtino Nacionalinio prevencinės medicinos tyrimų centro Maskva, Rusija, nepriklausomas etikos komitetas. Prieš įtraukiant į tyrimą iš visų tiriamųjų buvo gautas informuotas raštiškas sutikimas.

Sistolinis kraujospūdis (SBP) ir diastolinis kraujospūdis (DBP) buvo matuojami pailsėjus ilgiau nei penkias minutes pagal standartizuotą darbo procedūrą, naudojant kalibruotą sfigmomanometrą ir žasto pripūtimo manžetę (HEM-7200 M3, Omron Healthcare, Kiotas, Japonija). Buvo priimtas trijų nuoseklių rodmenų vidurkis.

Kūno masės indeksui (KMI, kg/m 2 ) apskaičiuoti buvo naudojami antropometriniai matavimai. Po naktinio badavimo serume nevalgius gliukozės (FG) ir glikozilinto hemoglobino (HbA)1c) buvo nustatyti naudojant įprastinius laboratorinius metodus biocheminiu analizatoriumi „Sapphire 400“ (Niigata Mechatronics, Japonija).

Insulino kiekis serume buvo kiekybiškai įvertintas naudojant chemiliuminescencinę mikrodalelę Immunoassay analizatoriuje 𠇊rchitect i 2000SR» (Abbot, Kanada) [22]. Atsparumo insulinui homeostazės modelio įvertinimas (HOMA-IR) = insulinas nevalgius (mU/ml) x FG (mmol/l)/22,5.

Gliukozės nevalgius sutrikimas (IFG) buvo diagnozuotas, jei FG ≥ 6,1 ir χ,0mmol/l. Atliekant geriamąjį gliukozės tolerancijos testą (OGTT), gliukozė nevalgius buvo matuojama prieš pradinį lygį ir gliukozė po/iššūkio, suleidus 75 g gliukozės 120 min. Tiriamieji buvo suskirstyti į normalią gliukozės toleranciją (2 val. gliukozės lygis χ,8 mmol/l) ir sutrikusią gliukozės toleranciją (IGT): 2 val. gliukozės lygis 7,8�,0 mmol/l po atrankos OGTT.

Arterijos standumas

Arterijos standumas buvo įvertintas pagal c-f PWV reikšmes. Jis buvo matuojamas naudojant SphygmoCor 8.0 aparatinę įrangą (Atcor, Sidnėjus), naudojant applanacinį tonometrą ir elektrokardiogramos blokavimą, kad būtų pasiektos pulso bangos tiek iš proksimalinių (miego arterijų), tiek iš distalinių (šlaunikaulio arterijų) vietų. C-f PWV buvo apskaičiuotas pagal tranzito tarp dviejų vietų laiką, palyginti su R banga elektrokardiogramos komplekse, naudojant ‘ pėdos iki pėdos metodą’ ir susikertančios liestinės algoritmą [23]. Kiekvienam tiriamajam buvo atliktos dvi matavimų sekos ir analizei buvo atsižvelgta į jų vidutinę vertę. Pakartojamumo koeficiento reikšmė buvo 0,935.

Leukocitų telomerų ilgio analizė

Lt nustatyta Cawthon [24] aprašytu metodu. Genominė dezoksiribonukleorūgštis (DNR) buvo ekstrahuota tiesiai iš kraujo mėginių standartinėmis procedūromis (OD260nm/280nm 1.8𠄱.9). Tyrimas apėmė telomero DNR gausos palyginimą su kiekvieno mėginio genominės DNR vienos kopijos skaičiumi ir toliau lyginant skirtingų šaltinių DNR normalizuotą vertę. Telomero (T) ir vienos kopijos santykis 36B4 geno(S) matricos atspindi telomerų ilgį (T/S santykis yra maždaug [2 C t (telomerai)/2 C t( 36B4) ] -1 = 2 -㥌 t [T1]). Vienu metu pradinis mišinys 1,25 x (1 x mišinys: PGR buferis 1 x (Fermentas 10X PCR Hotstartbuf + KCl), MgCl2 2 mM, dNTP 0,2 mM, 0,5 μM kiekvieno pradmens, 0,05 vnt. /b polimerazės maxa Fermentas), Sybr Green I 0,2x) buvo paruošti. Pradmenų sekos buvo: Tel1, GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT, Tel2, TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA. , 36B4u, CAAGTGGGAAGGTGTAATCC , 36B4d, CCCATTCTATCATCAACGGGTACAA . Į kiekvieną mėginio šulinėlį buvo įpilta šešiolika mikrolitrų pagrindinio mišinio ir įpilta 4 μl analizuotos genominės DNR, kurios koncentracija 10 ng/μl. Mėginiai buvo sumaišyti, centrifuguoti ir amplifikuoti termocikleryje CFX96. Telomerų polimerazės grandininei reakcijai (PGR) 5 minutes kaitinome 95 ° C temperatūroje ir atlikome 35 ciklus 95 ° C temperatūroje 20 sekundžių, 54 ° C temperatūroje 2 minutes, po to lydome. Kontrolinei PGR kaitinome 95 C temperatūroje 5 minutes. Tada mes atlikome 35 ciklus 95 ° C temperatūroje 20 sekundžių, 58 ° C temperatūroje 1 minutę, po to lydome. Atitinkamų telomerinių ir kontrolinių mišinių amplifikacija užima vieną ląstelės vienetą. Kiekvienam mėginiui atlikome tris pasikartojančias telomerines reakcijas ir tris kontrolines reakcijas. Apskaičiavome skirtumą tarp telomero ir vienos geno kopijos amplifikacijos ciklo slenksčių (㥌t) ir, remiantis šiais rezultatais, įvertino santykinį telomerų ilgį. Kaip atskaitos taškas buvo naudojama ląstelės HEK linijos genominė DNR ir kontrolinis leukocitų mėginys. Kad kartais būtų atsižvelgta į PGR mišinių skirtumus, nustatome leukocitų etaloninę vertę 㥌t (leu) reikšmė 8. Santykinis eksponentinis ilgis L buvo nustatytas L = 㥌t-(㥌t (leu)-8). Kadangi negauname absoliučios telomerų ilgių reikšmės, todėl kaip reikšmių sklaidos matą, buvo nuspręsta naudoti standartinį nuokrypį. Mūsų eksperimento metu standartinis nuokrypis beveik visais atvejais buvo 0,1–020130,4 diapazone, gautas iš santykinio ilgio nuo 8,30 iki 11,39 (logaritminė skalė).

Telomerazės aktyvumo analizė

Telomerazės aktyvumas (TA) buvo matuojamas naudojant Kim [25] aprašytą metodą. Atlikta ląstelinio ekstrakto iš baltųjų kraujo kūnelių monocitinės frakcijos (eritrocitai neleidžia analizuoti priemaišų), turinčio 2 mcg bendro baltymo, analizė. Ląstelės, gautos iš monocitinio žiedo ant Ficoll tankio gradiento ir išplautos PBS, buvo pakartotinai suspenduotos liziniame buferyje (10 mMTris-HCl ir 10 mM HEPES-KOH, pH 7,5, 1,0 mM MgCl2, 1 mM EGTA, 5 mM &#). x003b2-merkaptoetanolis, 5 % glicerolis, 0,5 % CHAPS, 0,1 mM PMSF). Ląstelės buvo inkubuojamos 30 minučių ant ledo, centrifuguojamos 10 minučių 4 ° C temperatūroje 15 000 g, o supernatanto tirpalas buvo surinktas. Ekstraktas buvo padalytas į alikvotinę dalį ir užšaldytas skystame azote. Telomerazės polimerazės reakcija buvo atlikta su 24μl 1,2x pagrindinio mišinio (1x mišinyje yra 1X TRAP buferis (1X TRAP buferis: 20 mM HEPES-KOH pH 8.3, 1,5mM MgCl2, 63 mMKCl, 1 mM EGTA, 0,1 mg/ml BSA, 0,005 % t/v Tween-20, 20 pM dNTP, 10 pmol oligonukleotido TS (AATCCGTCGAGCAGTT) ir kontrolinis 4 &cl#x0 ekstraktas. Reakcijos mišinys buvo inkubuojamas 30 minučių 25 ± 000 °C temperatūroje. Produktai buvo sustiprinti PGR realiuoju laiku. Po to 1,5 vieneto Taq-DNR polimerazės ("Helicon"), 10 pmol oligonukleotido ACX (CGCGGCTTACCCTTACCCTTACCCTTACC) ir Sybr Green I iki 0,2x galutinės koncentracijos mišinyje (kartu 2 μl tūrio). Realaus laiko PGR buvo atlikta įrenginiu CFX-96 35 s esant 94 °C, 35 s esant 50 °C, 90 s esant 72 °C temperatūrai (30 ciklų terminio ciklo „Mastercycler“ („Bio-Rad“)). Kaip kalibravimo kreivė HEK ląstelių linijos (15 ląstelių aktyvumas buvo nustatytas kaip 1) ir TSR8 (seka identiška TS pradmeniui, pratęstam 8 telomeriniais pasikartojimais AG (GGTTAG)) skiedimų serija.7) buvo panaudotas.

Statistinė analizė

Statistinei analizei buvo naudojamas SAS 9.1 (SAS institutas, Cary, NC, JAV). Vidutinės vertės ± standartinių nuokrypių (SD) nuolatinėms klinikinėms charakteristikoms ir atitinkamos proporcijos/dažniai kategoriškiems duomenims buvo apskaičiuotos ir pateiktos lentelėse. Pasiskirstymai buvo lyginami naudojant vienkryptį ANOVA nuolatiniams kintamiesiems, taip pat Chi kvadrato testą ir t testą (su Fišerio arcsinine transformacija) kategoriškiems/dvejetainiams kintamiesiems. Pirsono tiesinės koreliacijos ir Spearmano rango koreliacijos koeficientai buvo apskaičiuoti siekiant įvertinti dvimatį ryšį tarp c-f PWV ir LTL, taip pat klinikinius kintamuosius. Buvo atlikta daugkartinė tiesinė regresinė analizė, siekiant nustatyti bet kokius nepriklausomus ryšius tarp c-f PWV ir gliukozės metabolizmo parametrų plius LTL ir tarp Lt ir gliukozės metabolizmo parametrų. P reikšmės, mažesnės nei 0,05, buvo laikomos statistiškai reikšmingomis.


Abstraktus

Įvadas

Telomerai yra specializuoti DNR ir baltymų kompleksai, uždengiantys linijinių chromosomų galus, padedantys palaikyti DNR vientisumą ląstelių dalijimosi metu. Telomerų ilgis natūraliai trumpėja, kai ląstelės dalijasi iš eilės, ir yra biologinio amžiaus ląstelių žymeklis. Šiuo straipsniu siekiama pateikti telomerų biologijos apžvalgą ir apžvelgti bet kokio ryšio tarp kraujagyslių chirurginių būklių ir trumpo telomero ilgio įrodymus.

Metodai

A systematic review of the literature was performed using the search terms ‘telomere’ and ‘vascular’.

Rezultatai

Considerable associations between a shorter mean telomere length and coronary heart disease have been observed. This finding extends to vascular disease risk factors including age, sex, smoking, obesity, hypertension and diabetes. Vascular diseases including abdominal aortic aneurysm, peripheral vascular disease and carotid disease were also associated with shorter telomere lengths but evidence was limited to a small number of studies. There were no reports of short telomere length associated with varicose veins or arterio-venous malformations suggesting a novel area for further investigation.

Išvada

Multiple associations between short telomere length and vascular disease characterised by atherosclerosis suggest a possible link between telomere attrition and disease mechanisms. Further studies are warranted to validate and define the role of telomeres in vascular disease pathogenesis.


Exploring the Causal Pathway From Telomere Length to Coronary Heart Disease: A Network Mendelian Randomization Study

Loginis pagrindas: Observational studies have found shorter leukocyte telomere length (TL) to be a risk factor for coronary heart disease (CHD), and recently the association was suggested to be causal. However, the relationship between TL and common metabolic risk factors for CHD is not well understood. Whether these risk factors could explain pathways from TL to CHD warrants further attention.

Tikslas: To examine whether metabolic risk factors for CHD mediate the causal pathway from short TL to increased risk of CHD using a network Mendelian randomization design.

Methods and results: Summary statistics from several genome-wide association studies were used in a 2-sample Mendelian randomization study design. Network Mendelian randomization analysis-an approach using genetic variants as the instrumental variables for both the exposure and mediator to infer causality-was performed to examine the causal association between telomeres and CHD and metabolic risk factors. Summary statistics from the ENGAGE Telomere Consortium were used (n=37 684) as a TL genetic instrument, CARDIoGRAMplusC4D Consortium data were used (case=22 233 and control=64 762) for CHD, and other consortia data were used for metabolic traits (fasting insulin, triglyceride, total cholesterol, low-density lipoprotein cholesterol, fasting glucose, diabetes mellitus, glycohemoglobin, body mass index, waist circumference, and waist:hip ratio). One-unit increase of genetically determined TL was associated with -0.07 (95% confidence interval, -0.01 to -0.12 P=0.01) lower log-transformed fasting insulin (pmol/L) and 21% lower odds (95% confidence interval, 3-35 P=0.02) of CHD. Higher genetically determined log-transformed fasting insulin level was associated with higher CHD risk (odds ratio, 1.86 95% confidence interval, 1.01-3.41 P=0.04).

Išvados: Overall, our findings support a role of insulin as a mediator on the causal pathway from shorter telomeres to CHD pathogenesis.

Raktiniai žodžiai: body mass index cardiovascular diseases coronary disease diabetes mellitus insulin.